ID: 1143351605

View in Genome Browser
Species Human (GRCh38)
Location 17:6292053-6292075
Sequence AAGCCAGTGTCCAGGCTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143351598_1143351605 13 Left 1143351598 17:6292017-6292039 CCCCAGGTGCCTCACTCACTTCC No data
Right 1143351605 17:6292053-6292075 AAGCCAGTGTCCAGGCTGTAAGG No data
1143351599_1143351605 12 Left 1143351599 17:6292018-6292040 CCCAGGTGCCTCACTCACTTCCT No data
Right 1143351605 17:6292053-6292075 AAGCCAGTGTCCAGGCTGTAAGG No data
1143351597_1143351605 27 Left 1143351597 17:6292003-6292025 CCTTAAATTTTGCACCCCAGGTG No data
Right 1143351605 17:6292053-6292075 AAGCCAGTGTCCAGGCTGTAAGG No data
1143351603_1143351605 -8 Left 1143351603 17:6292038-6292060 CCTCTGGTCACTGCTAAGCCAGT No data
Right 1143351605 17:6292053-6292075 AAGCCAGTGTCCAGGCTGTAAGG No data
1143351600_1143351605 11 Left 1143351600 17:6292019-6292041 CCAGGTGCCTCACTCACTTCCTC No data
Right 1143351605 17:6292053-6292075 AAGCCAGTGTCCAGGCTGTAAGG No data
1143351602_1143351605 4 Left 1143351602 17:6292026-6292048 CCTCACTCACTTCCTCTGGTCAC No data
Right 1143351605 17:6292053-6292075 AAGCCAGTGTCCAGGCTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143351605 Original CRISPR AAGCCAGTGTCCAGGCTGTA AGG Intergenic