ID: 1143351607

View in Genome Browser
Species Human (GRCh38)
Location 17:6292056-6292078
Sequence CCAGTGTCCAGGCTGTAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143351599_1143351607 15 Left 1143351599 17:6292018-6292040 CCCAGGTGCCTCACTCACTTCCT No data
Right 1143351607 17:6292056-6292078 CCAGTGTCCAGGCTGTAAGGTGG No data
1143351603_1143351607 -5 Left 1143351603 17:6292038-6292060 CCTCTGGTCACTGCTAAGCCAGT No data
Right 1143351607 17:6292056-6292078 CCAGTGTCCAGGCTGTAAGGTGG No data
1143351600_1143351607 14 Left 1143351600 17:6292019-6292041 CCAGGTGCCTCACTCACTTCCTC No data
Right 1143351607 17:6292056-6292078 CCAGTGTCCAGGCTGTAAGGTGG No data
1143351602_1143351607 7 Left 1143351602 17:6292026-6292048 CCTCACTCACTTCCTCTGGTCAC No data
Right 1143351607 17:6292056-6292078 CCAGTGTCCAGGCTGTAAGGTGG No data
1143351597_1143351607 30 Left 1143351597 17:6292003-6292025 CCTTAAATTTTGCACCCCAGGTG No data
Right 1143351607 17:6292056-6292078 CCAGTGTCCAGGCTGTAAGGTGG No data
1143351598_1143351607 16 Left 1143351598 17:6292017-6292039 CCCCAGGTGCCTCACTCACTTCC No data
Right 1143351607 17:6292056-6292078 CCAGTGTCCAGGCTGTAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143351607 Original CRISPR CCAGTGTCCAGGCTGTAAGG TGG Intergenic