ID: 1143351608

View in Genome Browser
Species Human (GRCh38)
Location 17:6292063-6292085
Sequence GAGGAGTCCACCTTACAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143351608_1143351612 5 Left 1143351608 17:6292063-6292085 CCAGGCTGTAAGGTGGACTCCTC No data
Right 1143351612 17:6292091-6292113 CAACCTGTGGTGAAACCTACAGG No data
1143351608_1143351609 -8 Left 1143351608 17:6292063-6292085 CCAGGCTGTAAGGTGGACTCCTC No data
Right 1143351609 17:6292078-6292100 GACTCCTCAACCACAACCTGTGG No data
1143351608_1143351616 28 Left 1143351608 17:6292063-6292085 CCAGGCTGTAAGGTGGACTCCTC No data
Right 1143351616 17:6292114-6292136 CCTCTCTCTGCTTCCCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143351608 Original CRISPR GAGGAGTCCACCTTACAGCC TGG (reversed) Intergenic