ID: 1143351609

View in Genome Browser
Species Human (GRCh38)
Location 17:6292078-6292100
Sequence GACTCCTCAACCACAACCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143351603_1143351609 17 Left 1143351603 17:6292038-6292060 CCTCTGGTCACTGCTAAGCCAGT No data
Right 1143351609 17:6292078-6292100 GACTCCTCAACCACAACCTGTGG No data
1143351608_1143351609 -8 Left 1143351608 17:6292063-6292085 CCAGGCTGTAAGGTGGACTCCTC No data
Right 1143351609 17:6292078-6292100 GACTCCTCAACCACAACCTGTGG No data
1143351602_1143351609 29 Left 1143351602 17:6292026-6292048 CCTCACTCACTTCCTCTGGTCAC No data
Right 1143351609 17:6292078-6292100 GACTCCTCAACCACAACCTGTGG No data
1143351606_1143351609 -1 Left 1143351606 17:6292056-6292078 CCAGTGTCCAGGCTGTAAGGTGG No data
Right 1143351609 17:6292078-6292100 GACTCCTCAACCACAACCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143351609 Original CRISPR GACTCCTCAACCACAACCTG TGG Intergenic