ID: 1143351612

View in Genome Browser
Species Human (GRCh38)
Location 17:6292091-6292113
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143351608_1143351612 5 Left 1143351608 17:6292063-6292085 CCAGGCTGTAAGGTGGACTCCTC No data
Right 1143351612 17:6292091-6292113 CAACCTGTGGTGAAACCTACAGG No data
1143351606_1143351612 12 Left 1143351606 17:6292056-6292078 CCAGTGTCCAGGCTGTAAGGTGG No data
Right 1143351612 17:6292091-6292113 CAACCTGTGGTGAAACCTACAGG No data
1143351603_1143351612 30 Left 1143351603 17:6292038-6292060 CCTCTGGTCACTGCTAAGCCAGT No data
Right 1143351612 17:6292091-6292113 CAACCTGTGGTGAAACCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143351612 Original CRISPR CAACCTGTGGTGAAACCTAC AGG Intergenic