ID: 1143351616

View in Genome Browser
Species Human (GRCh38)
Location 17:6292114-6292136
Sequence CCTCTCTCTGCTTCCCTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143351610_1143351616 9 Left 1143351610 17:6292082-6292104 CCTCAACCACAACCTGTGGTGAA No data
Right 1143351616 17:6292114-6292136 CCTCTCTCTGCTTCCCTCACAGG No data
1143351613_1143351616 -3 Left 1143351613 17:6292094-6292116 CCTGTGGTGAAACCTACAGGCCT No data
Right 1143351616 17:6292114-6292136 CCTCTCTCTGCTTCCCTCACAGG No data
1143351608_1143351616 28 Left 1143351608 17:6292063-6292085 CCAGGCTGTAAGGTGGACTCCTC No data
Right 1143351616 17:6292114-6292136 CCTCTCTCTGCTTCCCTCACAGG No data
1143351611_1143351616 3 Left 1143351611 17:6292088-6292110 CCACAACCTGTGGTGAAACCTAC No data
Right 1143351616 17:6292114-6292136 CCTCTCTCTGCTTCCCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143351616 Original CRISPR CCTCTCTCTGCTTCCCTCAC AGG Intergenic