ID: 1143354224

View in Genome Browser
Species Human (GRCh38)
Location 17:6313421-6313443
Sequence ACAGGGCCCTCGAGTGAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143354218_1143354224 3 Left 1143354218 17:6313395-6313417 CCTGTGGAATCTCTCAACTCAAG No data
Right 1143354224 17:6313421-6313443 ACAGGGCCCTCGAGTGAAAGGGG No data
1143354217_1143354224 4 Left 1143354217 17:6313394-6313416 CCCTGTGGAATCTCTCAACTCAA No data
Right 1143354224 17:6313421-6313443 ACAGGGCCCTCGAGTGAAAGGGG No data
1143354216_1143354224 13 Left 1143354216 17:6313385-6313407 CCAACAGAGCCCTGTGGAATCTC No data
Right 1143354224 17:6313421-6313443 ACAGGGCCCTCGAGTGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143354224 Original CRISPR ACAGGGCCCTCGAGTGAAAG GGG Intergenic
No off target data available for this crispr