ID: 1143355028

View in Genome Browser
Species Human (GRCh38)
Location 17:6321298-6321320
Sequence GGAGTCTTGTGTGCTGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143355025_1143355028 3 Left 1143355025 17:6321272-6321294 CCATTGTGGAACTTCGGGATCCA No data
Right 1143355028 17:6321298-6321320 GGAGTCTTGTGTGCTGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143355028 Original CRISPR GGAGTCTTGTGTGCTGCTGC AGG Intergenic
No off target data available for this crispr