ID: 1143357669

View in Genome Browser
Species Human (GRCh38)
Location 17:6342591-6342613
Sequence CCTGACCCAGCCCTCTGTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143357669_1143357673 15 Left 1143357669 17:6342591-6342613 CCTAAACAGAGGGCTGGGTCAGG No data
Right 1143357673 17:6342629-6342651 GTAATGAGGCATGATCTGATTGG 0: 10
1: 17
2: 51
3: 73
4: 175
1143357669_1143357672 1 Left 1143357669 17:6342591-6342613 CCTAAACAGAGGGCTGGGTCAGG No data
Right 1143357672 17:6342615-6342637 TTTATAGGCATGAAGTAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143357669 Original CRISPR CCTGACCCAGCCCTCTGTTT AGG (reversed) Intergenic
No off target data available for this crispr