ID: 1143360862

View in Genome Browser
Species Human (GRCh38)
Location 17:6369626-6369648
Sequence TGATTGATAGATCACTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143360862_1143360870 19 Left 1143360862 17:6369626-6369648 CCCCCAAAGTGATCTATCAATCA No data
Right 1143360870 17:6369668-6369690 GAGTTTTTGAATTGACAAGTTGG No data
1143360862_1143360866 -3 Left 1143360862 17:6369626-6369648 CCCCCAAAGTGATCTATCAATCA No data
Right 1143360866 17:6369646-6369668 TCACAATCCCAAATTCCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143360862 Original CRISPR TGATTGATAGATCACTTTGG GGG (reversed) Intergenic
No off target data available for this crispr