ID: 1143361200

View in Genome Browser
Species Human (GRCh38)
Location 17:6372744-6372766
Sequence ACTGGAAGCAGATGACAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143361200_1143361205 7 Left 1143361200 17:6372744-6372766 CCTTATTGTCATCTGCTTCCAGT No data
Right 1143361205 17:6372774-6372796 AAAAAAAAGAAGGAGGCAGGAGG No data
1143361200_1143361206 8 Left 1143361200 17:6372744-6372766 CCTTATTGTCATCTGCTTCCAGT No data
Right 1143361206 17:6372775-6372797 AAAAAAAGAAGGAGGCAGGAGGG No data
1143361200_1143361204 4 Left 1143361200 17:6372744-6372766 CCTTATTGTCATCTGCTTCCAGT No data
Right 1143361204 17:6372771-6372793 GAGAAAAAAAAGAAGGAGGCAGG No data
1143361200_1143361202 -3 Left 1143361200 17:6372744-6372766 CCTTATTGTCATCTGCTTCCAGT No data
Right 1143361202 17:6372764-6372786 AGTCAGAGAGAAAAAAAAGAAGG No data
1143361200_1143361203 0 Left 1143361200 17:6372744-6372766 CCTTATTGTCATCTGCTTCCAGT No data
Right 1143361203 17:6372767-6372789 CAGAGAGAAAAAAAAGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143361200 Original CRISPR ACTGGAAGCAGATGACAATA AGG (reversed) Intergenic
No off target data available for this crispr