ID: 1143361204

View in Genome Browser
Species Human (GRCh38)
Location 17:6372771-6372793
Sequence GAGAAAAAAAAGAAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143361200_1143361204 4 Left 1143361200 17:6372744-6372766 CCTTATTGTCATCTGCTTCCAGT No data
Right 1143361204 17:6372771-6372793 GAGAAAAAAAAGAAGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143361204 Original CRISPR GAGAAAAAAAAGAAGGAGGC AGG Intergenic
No off target data available for this crispr