ID: 1143365603

View in Genome Browser
Species Human (GRCh38)
Location 17:6406559-6406581
Sequence GACACAGGACAGGTAGGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 343}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143365603_1143365615 28 Left 1143365603 17:6406559-6406581 CCGGGCCCTACCTGTCCTGTGTC 0: 1
1: 0
2: 0
3: 31
4: 343
Right 1143365615 17:6406610-6406632 GAGTGATCACTCATAAAGAAGGG 0: 1
1: 0
2: 0
3: 7
4: 139
1143365603_1143365611 6 Left 1143365603 17:6406559-6406581 CCGGGCCCTACCTGTCCTGTGTC 0: 1
1: 0
2: 0
3: 31
4: 343
Right 1143365611 17:6406588-6406610 GTGAATGACCCACACATGTGCGG 0: 1
1: 0
2: 2
3: 12
4: 104
1143365603_1143365614 27 Left 1143365603 17:6406559-6406581 CCGGGCCCTACCTGTCCTGTGTC 0: 1
1: 0
2: 0
3: 31
4: 343
Right 1143365614 17:6406609-6406631 GGAGTGATCACTCATAAAGAAGG 0: 1
1: 0
2: 1
3: 8
4: 66
1143365603_1143365616 29 Left 1143365603 17:6406559-6406581 CCGGGCCCTACCTGTCCTGTGTC 0: 1
1: 0
2: 0
3: 31
4: 343
Right 1143365616 17:6406611-6406633 AGTGATCACTCATAAAGAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143365603 Original CRISPR GACACAGGACAGGTAGGGCC CGG (reversed) Intronic
900048736 1:529325-529347 GACAGAGGAGAGGCAGGGGCAGG + Intergenic
900070967 1:771149-771171 GACAGAGGAGAGGCAGGGGCAGG + Intergenic
900104085 1:974807-974829 GTCACAGGTCAGGGAGGTCCTGG + Exonic
900123798 1:1060642-1060664 GACACAGAAGAGCCAGGGCCTGG + Intergenic
900158333 1:1212348-1212370 GGCACAGGACAGGGAGGTGCTGG - Intronic
900562904 1:3316467-3316489 GATTCAGGACAGGGAGGACCTGG + Intronic
900799241 1:4727312-4727334 AACACAGGGAAGGTGGGGCCGGG - Intronic
901663975 1:10816045-10816067 GACAGAGGCCAGGCAGGGTCAGG + Intergenic
901731617 1:11284334-11284356 GAGGCAGGAGAGGTAGGGCTGGG + Intronic
902490191 1:16775818-16775840 TGCACACGACAGGTAGGGGCTGG - Intronic
902625706 1:17675117-17675139 AACCCAGAACAGGTAGGGCTGGG - Intronic
903537049 1:24073968-24073990 GCCACAGGCCAGGTAGGCCCTGG - Intronic
903860569 1:26361936-26361958 GACACTGCACTGGAAGGGCCGGG + Exonic
904615504 1:31747340-31747362 AGCACAGGAGAGGCAGGGCCTGG - Intronic
904818918 1:33227743-33227765 GAAACAGGAATGGTAGAGCCAGG - Intergenic
905769547 1:40628781-40628803 GTCACAGGGCAAGTAGGGCAGGG - Intronic
907112197 1:51936230-51936252 GACACATGAGAGGGAGGGCCAGG - Intronic
907481003 1:54745497-54745519 GCCAGAGTACAGGCAGGGCCAGG + Intergenic
908794394 1:67816716-67816738 CTCCCAGGACAGGTAGGGCCCGG + Intronic
908960881 1:69695675-69695697 GGCACAGGGCAGCAAGGGCCTGG - Intronic
910241711 1:85093792-85093814 GACACATGACAGTGAGGGCGTGG - Intronic
911003344 1:93190970-93190992 GACACAGTACAAGAAGGGCAAGG - Intronic
911942779 1:104068986-104069008 GTCACAGAAGAGGTAGGGCCTGG + Intergenic
912691654 1:111809267-111809289 GAAACAGAACCGGTAAGGCCAGG - Intronic
915341572 1:155179462-155179484 GGCACAGGAGGGGTAGGGCAGGG - Intronic
917453814 1:175168902-175168924 GAGAGAGAACAGGGAGGGCCCGG - Intronic
917687102 1:177428007-177428029 GACACAGGAGAGGAAGGGCTGGG - Intergenic
922106331 1:222516599-222516621 GACAGAGGACAGGCAGGGGCAGG + Intergenic
922675065 1:227544671-227544693 GGCACTGGACATGTGGGGCCAGG + Intergenic
923530247 1:234806712-234806734 TGCACATGACAGGTAGGGGCTGG + Intergenic
924056232 1:240127077-240127099 GCCACAGCACAGGCAGGGTCTGG + Intronic
924348511 1:243094164-243094186 GACAGAGGAGAGGCAGGGGCAGG + Intergenic
1063110877 10:3036250-3036272 AACACAGGACAAGTATGCCCGGG - Intergenic
1063623326 10:7667536-7667558 GGGACAGGAGAGGTGGGGCCGGG - Intergenic
1063980852 10:11450749-11450771 GACACTGGTCAGGTGAGGCCAGG - Intergenic
1065484865 10:26227861-26227883 GATACAGGACAGGTAGAATCAGG - Intronic
1066065637 10:31759524-31759546 ACCGCAGGACAGGTAGGGGCGGG + Intergenic
1066727848 10:38410737-38410759 GACAGAGGAGAGGCAGGGGCAGG - Intergenic
1067194628 10:44105789-44105811 AACACAGGACAAATAGGGGCTGG + Intergenic
1067274828 10:44824756-44824778 GACAAAGCACAGGCAGGTCCTGG - Intergenic
1067479291 10:46584862-46584884 GAAACAGGAGGGGCAGGGCCTGG - Intronic
1067575280 10:47404744-47404766 CAGACAGGACTGGTTGGGCCAGG - Intergenic
1067615448 10:47756939-47756961 GAAACAGGAGGGGCAGGGCCTGG + Intergenic
1068107228 10:52634039-52634061 AAAACAGGACAGGTTGGGCATGG + Intergenic
1070794286 10:79207876-79207898 GATCCAGGACAGGTTGGCCCTGG - Intronic
1071158782 10:82722147-82722169 GAAACAGAACATGTGGGGCCTGG + Intronic
1072915688 10:99536161-99536183 GGCAGAGGATCGGTAGGGCCTGG - Exonic
1074049342 10:109867984-109868006 GACCCTGGACTGGTAAGGCCAGG - Intronic
1075639760 10:124056283-124056305 GACACAGGACAGGAAGGTGAGGG + Intronic
1076663460 10:132070436-132070458 GACAGAGGACAGGTCGGGCGCGG - Intergenic
1076732509 10:132445768-132445790 GGCAGAGGACAGGTGGGTCCTGG + Exonic
1076975083 11:165926-165948 GACAGAGGAGAGGAAGGGGCAGG + Intergenic
1077009110 11:372325-372347 GACACAGGACATGTGGGGCACGG + Intronic
1077050839 11:566112-566134 GCCACAGGTCAGGCAGGTCCAGG - Intergenic
1077069150 11:659945-659967 AACACAGGGCAGGTGGGGCCAGG + Intronic
1077331501 11:1985812-1985834 GACCCAGGGCAGGTGGGGGCTGG + Intergenic
1077532586 11:3104103-3104125 CCCACAGGGCAGGTAGGGGCTGG + Intronic
1077722747 11:4644331-4644353 GACAGAGGACAGGCTGGGCTGGG + Intronic
1078145874 11:8721563-8721585 CACACAGGACAGAAAGGGCCAGG + Intronic
1079029402 11:16974923-16974945 GACACAGTACAAGAAGGGCAAGG - Intronic
1081802426 11:45869311-45869333 GGCACAGTGCAGGCAGGGCCTGG + Intronic
1081804372 11:45882438-45882460 GACAGAGGACAGTGAGGGACAGG - Exonic
1081876409 11:46411353-46411375 GACAGAGACCAGGCAGGGCCTGG + Intronic
1081913968 11:46719271-46719293 TACACAGGGCAGCCAGGGCCAGG - Exonic
1082000986 11:47393663-47393685 GGAACAGGACAGTGAGGGCCAGG + Intergenic
1082790205 11:57341837-57341859 GGAACAGGGCAGGTAGGGCAGGG - Intronic
1082921359 11:58498134-58498156 GAAACAGGACAAGCAGGGGCAGG + Intergenic
1083151770 11:60796058-60796080 GAGACAGGACAGAGAAGGCCTGG + Intronic
1083354992 11:62059629-62059651 GCCACAGTACAGGTCGGGCACGG - Intergenic
1083425302 11:62581330-62581352 GACACAGGAGAGCAAAGGCCAGG + Intronic
1083775143 11:64890975-64890997 GCCACAGGGCAGGCAGGGCAGGG + Intergenic
1084180124 11:67441939-67441961 GGCACAGGACTGGCTGGGCCAGG - Intronic
1084673706 11:70622319-70622341 GGCACAGCACAGGTGGGGGCGGG - Intronic
1085197643 11:74682122-74682144 GACACAGGGCAAATAGGGGCTGG + Intergenic
1086895842 11:92311801-92311823 GACACTGGACAGTGAGGGACTGG - Intergenic
1088626167 11:111732144-111732166 GACGCAGGACAGGTGGGAACAGG + Intronic
1089097331 11:115930300-115930322 GAGAAAGGACAGGAAGGGGCTGG + Intergenic
1089247999 11:117136634-117136656 CAAGCAGGAAAGGTAGGGCCTGG - Intergenic
1089258715 11:117207927-117207949 CAAGCAGGAAAGGTAGGGCCTGG + Intronic
1090414132 11:126529125-126529147 GACACAGGACGGGGAGAGACCGG - Intronic
1202814482 11_KI270721v1_random:40988-41010 GACCCAGGGCAGGTGGGGGCTGG + Intergenic
1091596285 12:1881145-1881167 GACAGAGGAGATGTAGGGACTGG + Intronic
1091889927 12:4045257-4045279 GACAAAGGACAGAGAGAGCCCGG - Intergenic
1092918834 12:13212723-13212745 CACACTGGAAAGGTGGGGCCGGG - Intronic
1093652064 12:21657465-21657487 CACCAAGGACAAGTAGGGCCTGG + Exonic
1096980920 12:55728023-55728045 GTCACCAGACAGGAAGGGCCAGG + Intronic
1099024084 12:77443718-77443740 GACACAGCCTAGGTAGGTCCTGG - Intergenic
1099048390 12:77752624-77752646 GACATATGAGTGGTAGGGCCAGG - Intergenic
1099085007 12:78235162-78235184 GACAGATGACAGATAGGGCCAGG + Intergenic
1101525367 12:105523565-105523587 GACAAAGGACAGGGAGGACAGGG + Intergenic
1101606048 12:106248150-106248172 GACCCCGGAGAGGGAGGGCCGGG + Intronic
1101834315 12:108284638-108284660 TACCCAGGACAGGTAGTGGCAGG - Intergenic
1102173955 12:110862378-110862400 GAGGAAGGCCAGGTAGGGCCTGG - Intronic
1102392294 12:112559011-112559033 GACAAATGACAGGTAGGACATGG + Intergenic
1102778564 12:115542928-115542950 GACACTAGACATGTAGGGGCGGG + Intergenic
1103393198 12:120589075-120589097 GCCACAGGACTGGTGTGGCCCGG + Intergenic
1103704419 12:122863544-122863566 GAAACAGGACAGGGTGGGTCAGG + Intergenic
1104748465 12:131224064-131224086 GACACAGGACAGCTGGGGAAGGG + Intergenic
1105006534 12:132724561-132724583 GACTCAGGGCAGGTATGGCGGGG + Intergenic
1107535211 13:41322632-41322654 GACACAGGACAGACACAGCCAGG - Intronic
1110499052 13:76204694-76204716 GATACTGGACAAGTAGGGTCAGG - Intergenic
1113704111 13:112414700-112414722 GACACAGAAAAGGTTGGGCACGG - Intronic
1114588483 14:23836793-23836815 GAAAAAGAACAGGTAAGGCCAGG - Intergenic
1117533629 14:56683651-56683673 GACACAGTACAAGAAGGGCAAGG - Intronic
1118480299 14:66158187-66158209 GCTATAGGGCAGGTAGGGCCAGG - Intergenic
1121273319 14:92651962-92651984 GGCAAAGGACAGGCAGGGGCGGG - Exonic
1121359552 14:93244077-93244099 GACACAGTAGAGGAAGGGCAAGG + Intronic
1123047808 14:105527069-105527091 GACCCAGGACAGGTGGGCCTGGG + Intronic
1123448773 15:20347402-20347424 AACACAGGACAGGCCGGGCACGG - Intergenic
1124023857 15:25946549-25946571 GGCTCAGGACAGGAAGTGCCGGG + Intergenic
1124253297 15:28121721-28121743 GGCACAGAACAGGGAGGGCTGGG + Intronic
1125016567 15:34943148-34943170 GACACAGTACAAGAAGGGCAAGG + Intronic
1127992669 15:64132420-64132442 GACACAGCACAGGAAGGCTCTGG - Intronic
1128152706 15:65373209-65373231 GACACAGGCCAGGGAGGGTATGG + Intronic
1128767075 15:70257772-70257794 GACACAGGACACATGGGGGCAGG + Intergenic
1129709146 15:77811426-77811448 GACACAGGAGAGGCAGGGGAGGG - Intronic
1131830863 15:96353929-96353951 AACACAGGCCACGGAGGGCCAGG - Intergenic
1132050115 15:98600603-98600625 GACAGAGAGCAGGCAGGGCCAGG - Intergenic
1132523558 16:402428-402450 GAAAGAGGCCAGGTTGGGCCGGG - Intronic
1132567230 16:629077-629099 GCAACAGGACAGGTGGGGCCAGG - Exonic
1132592196 16:730957-730979 GACACTGGAGAAGGAGGGCCAGG - Exonic
1132785072 16:1652394-1652416 GAGCCAGGCCAGGTGGGGCCTGG - Intronic
1132973545 16:2700621-2700643 AACTCAGGACAGGGAGGGCTGGG - Intronic
1132981294 16:2739813-2739835 GCCACTGGCCAGGTGGGGCCAGG - Intergenic
1133234782 16:4382708-4382730 GACAAAGGGCAGGTGGGGCCAGG + Exonic
1133234841 16:4382908-4382930 GAGACAGGGCAGCTGGGGCCGGG + Exonic
1133966410 16:10535207-10535229 GAAGCAGAACAGGGAGGGCCAGG + Intronic
1133974513 16:10591107-10591129 GACCAAGGACAGCCAGGGCCAGG + Intergenic
1134250667 16:12571648-12571670 GACTCAGGAACGGTAGGGCTGGG + Exonic
1134493291 16:14712143-14712165 GCAACAGGACAGGCAGGGCAAGG - Intronic
1134498672 16:14751267-14751289 GCAACAGGACAGGCAGGGCAAGG - Intronic
1136345393 16:29672212-29672234 GTCAGAGGAGAGATAGGGCCAGG - Intronic
1136682670 16:31977093-31977115 GACACTGGAAAGGTGTGGCCTGG + Intergenic
1136782930 16:32918261-32918283 GACACTGGAAAGGTGTGGCCTGG + Intergenic
1136886864 16:33935589-33935611 GACACTGGAAAGGTGTGGCCTGG - Intergenic
1137494486 16:48959205-48959227 GACACGAGACAGGCAGGGGCAGG - Intergenic
1138105392 16:54284953-54284975 GACTCAGGACCGGTAGTGGCCGG + Exonic
1138414852 16:56865802-56865824 GAGACAGGGCAAGAAGGGCCTGG + Intronic
1140042863 16:71420562-71420584 GGCACAGGACAAGAAGGGCAAGG + Intergenic
1140126929 16:72125484-72125506 GGCAGAGGACAGGAAGGGACTGG - Intronic
1141464293 16:84196172-84196194 GACACTGTCCAGGCAGGGCCGGG - Exonic
1141894105 16:86947485-86947507 GGCAGAGGACGGGTTGGGCCTGG - Intergenic
1142187106 16:88699737-88699759 GAGACAGGGCAGGGAGGGCAAGG + Intronic
1142396969 16:89837575-89837597 GACACACGCCAGGCAGGGGCTGG + Intronic
1142445180 16:90131733-90131755 GACAGAGGAGAGGCAGGGGCAGG - Intergenic
1203085579 16_KI270728v1_random:1182245-1182267 GACACTGGAAAGGTGTGGCCTGG + Intergenic
1143365603 17:6406559-6406581 GACACAGGACAGGTAGGGCCCGG - Intronic
1143596603 17:7917973-7917995 AAAAAAGGACTGGTAGGGCCAGG + Intergenic
1144371113 17:14592669-14592691 GACCCAGGAGAGGTAGGTGCTGG + Intergenic
1146772359 17:35580550-35580572 GAAAAAGGAAAGGTAGGGCCTGG + Intronic
1147143194 17:38470435-38470457 GACACTGGAAAGGTGTGGCCGGG + Intronic
1147161417 17:38571503-38571525 GGCAGAGGGCAGGAAGGGCCAGG + Intronic
1147164807 17:38587431-38587453 GACACAGGACGGGTAAGGAGGGG - Intronic
1147766433 17:42839637-42839659 CACACAACACAGGTAGAGCCTGG - Intronic
1147768257 17:42851164-42851186 GACACAGGAAGGCTAGGGCAAGG - Exonic
1148152521 17:45405000-45405022 GTCAAGGGAGAGGTAGGGCCGGG + Exonic
1149621219 17:58046749-58046771 GATTCAGGGCAGGCAGGGCCAGG + Intergenic
1149964842 17:61151936-61151958 GACACAGTACCGGAAGGGCAAGG + Intronic
1151327105 17:73386234-73386256 GCCACAGGCCAGGCTGGGCCTGG + Intronic
1151554099 17:74837887-74837909 GCTCCAGGACAGGTGGGGCCAGG - Exonic
1151869019 17:76824040-76824062 GACACAGCCCAGGAAGGGCTGGG - Intergenic
1152340023 17:79719184-79719206 AACACAGGACAGGCCGGGCGTGG + Intergenic
1152418037 17:80175716-80175738 GACGCTGAACAGGCAGGGCCTGG + Intronic
1152495758 17:80670281-80670303 GACAAGGGACGGGTAGGACCTGG - Intronic
1153051590 18:906770-906792 GACACAGGACGGGTAGAGATGGG - Intronic
1154388918 18:13919833-13919855 GACACAGTACAAGAAGGGCAAGG - Intergenic
1156463678 18:37335638-37335660 GACACAGGCCAGGGAGGACAGGG - Intronic
1156946940 18:42844645-42844667 GGCACAGGATAGGCAGGGCAGGG + Intronic
1157296406 18:46448150-46448172 GACACAGGAGAGTCAGGGCATGG - Intronic
1157310317 18:46547630-46547652 GACAGAGTGAAGGTAGGGCCAGG + Intronic
1158882420 18:61793651-61793673 GATAAAGGAAAGGTAAGGCCAGG + Intergenic
1160428619 18:78795946-78795968 GACACCAGACAGGTAGGGGAAGG + Intergenic
1160457109 18:79009108-79009130 GACACAGGCCAGGGAGTGGCGGG - Intergenic
1160581743 18:79887181-79887203 GACACAGGACAGATGGGGACAGG + Intronic
1160652035 19:236109-236131 GACAGAGGAGAGGAAGGGGCAGG + Intergenic
1162160112 19:8705806-8705828 GACACAGAAAAAATAGGGCCCGG + Intergenic
1162756847 19:12865878-12865900 GCCACAGCACAGGCTGGGCCTGG - Intronic
1164013717 19:21233403-21233425 GACACAGTACAAGAAGGGCAAGG + Intronic
1166339579 19:42129585-42129607 GGGACAGGACAAGTGGGGCCAGG - Intronic
1166363978 19:42269403-42269425 GACACAGGAAAGGGGGGTCCGGG + Intronic
1166442095 19:42823893-42823915 GAACCAGGAGAGGCAGGGCCCGG + Intronic
1166461519 19:42992176-42992198 GAACCAGGAGAGGCAGGGCCCGG + Intronic
1166478812 19:43152161-43152183 GAACCAGGAGAGGCAGGGCCCGG + Intronic
1166501485 19:43344492-43344514 GAACCAGGAGAGGCAGGGCCCGG + Intergenic
1166508631 19:43388966-43388988 GAACCAGGAGAGGCAGGGCCCGG - Intergenic
1166711782 19:44942301-44942323 GGCACAGGGCAGGCAGGGCCTGG - Exonic
1167148446 19:47695763-47695785 GACACAGGACGGGAAGGACAGGG + Intronic
1167239226 19:48333512-48333534 GGCAAAGAACAGGAAGGGCCTGG + Intronic
1167702669 19:51059854-51059876 GACACCCGACAGGTGGTGCCAGG + Exonic
1167850790 19:52200146-52200168 GAGGCAGAACAGGTAGGGACAGG - Intronic
1168459505 19:56541574-56541596 GAGCCAGGTCATGTAGGGCCTGG - Intronic
1168723563 19:58568915-58568937 GCATCAGGACAGGTAGGGCTGGG - Intronic
925429722 2:3780629-3780651 GAGACAGGACAGGGAGGGCTGGG + Intronic
926193134 2:10742934-10742956 GAGGCAGGGCAGGTAGGGACTGG - Intronic
927480910 2:23453305-23453327 CACACAGGACAGGTAGTTCCCGG - Intronic
928424273 2:31165308-31165330 GACACAGGGCAGGGACGGCCTGG - Intergenic
928941021 2:36727421-36727443 GACAGAGTACAGGAAGGGCCAGG + Intronic
929605718 2:43232820-43232842 CACACAGGACGGCCAGGGCCAGG + Exonic
932599029 2:73111746-73111768 GACACAGGACACAGAGGGACAGG + Intronic
933813461 2:86047861-86047883 AACACAGGAGAGGCAGAGCCTGG + Intronic
936092882 2:109512274-109512296 GATGCAGGGCAGGGAGGGCCGGG - Intergenic
937083452 2:119156506-119156528 TAGACTGGACAGGCAGGGCCGGG - Exonic
937868111 2:126768984-126769006 TAAACAGAAGAGGTAGGGCCAGG + Intergenic
937870261 2:126781375-126781397 GACCCGGGACAGGCAGGACCCGG + Intergenic
937870273 2:126781407-126781429 GACCCGGGACAGGCAGGACCTGG + Intergenic
938305892 2:130253765-130253787 GACAGAGGAGAGGTAAGGTCTGG - Intergenic
939865146 2:147464307-147464329 GACACAGGGGAGGTACGGCTTGG - Intergenic
942072600 2:172329271-172329293 GAGACTGGACAGATAGGGGCTGG + Intergenic
942377560 2:175353065-175353087 AAAACAGAACAGGGAGGGCCGGG - Intergenic
943367699 2:186981546-186981568 AACACTGGGCAAGTAGGGCCAGG - Intergenic
944789879 2:203114110-203114132 GACACAGGAGAGGCTGGGCGCGG - Intronic
945186708 2:207146875-207146897 CAGATAGGACAGGTAGGGCACGG + Intronic
946855393 2:223945137-223945159 CAGCGAGGACAGGTAGGGCCCGG - Exonic
947642524 2:231714910-231714932 CACACAGGGCAGGTAGCGCTTGG + Intergenic
947697253 2:232202061-232202083 GACAAAGGACAGGACGGGTCTGG - Intronic
948294445 2:236850166-236850188 GACACAGGGCAAGTAGGGACAGG + Intergenic
948403928 2:237703563-237703585 GAAACAGGACAAGCAGAGCCGGG - Intronic
948631597 2:239306464-239306486 GACACAGGATAGCTTGGCCCTGG - Intronic
948703875 2:239777647-239777669 GACTCAGGCCAGGGTGGGCCGGG - Intronic
948858148 2:240740208-240740230 GACACAGGCAGGGTAGGGGCAGG + Intronic
1170540295 20:17380916-17380938 GAGGCAGGACAGGGAGGGCTGGG - Intronic
1170764610 20:19279428-19279450 GAAACATGACAGGTGGGGCCTGG - Intronic
1170869839 20:20195511-20195533 GACACAGGACAGGCTGGCCCAGG + Intronic
1172209521 20:33187095-33187117 GACTGAGGACAGTGAGGGCCAGG + Intergenic
1172658413 20:36550347-36550369 TACGCAGGGCAGGCAGGGCCGGG + Exonic
1172948514 20:38706641-38706663 GACGCAGGACAGCTTGCGCCTGG - Intergenic
1173746808 20:45443906-45443928 GACATAGGAAAGTGAGGGCCTGG - Intergenic
1174744210 20:53045546-53045568 GAATCAGGATAGGTAGAGCCTGG - Intronic
1174888742 20:54366010-54366032 GATACAGGACATGTAGTCCCTGG + Intergenic
1175489660 20:59371350-59371372 GACACAGGACTGGTGGTGCAGGG - Intergenic
1179552558 21:42152766-42152788 GCAAGAGCACAGGTAGGGCCAGG - Intergenic
1179834323 21:44019423-44019445 GACACAGGACAGGAAGCCACAGG - Intronic
1180710903 22:17838880-17838902 GACACAGGACGGGAAGTGCGTGG - Intronic
1181846880 22:25717374-25717396 AACAAAGGAGAGGGAGGGCCAGG - Intronic
1183642429 22:39100800-39100822 GAGGCAGGGCAGGTAGGGGCTGG - Intronic
1183908080 22:41058005-41058027 GACACGGGAGAGGTGGGCCCTGG - Intergenic
1184120120 22:42444588-42444610 GAGGCCGGACAGGAAGGGCCAGG + Intergenic
1184744142 22:46446296-46446318 GGCAGAGGACAGGTACAGCCAGG - Intronic
1184769235 22:46588150-46588172 GACTCAGGATAGGCAGGCCCTGG + Intronic
1185242091 22:49752085-49752107 GACACTGAACAGAAAGGGCCTGG + Intergenic
950091838 3:10301242-10301264 GTGACAAGACAGGTGGGGCCTGG - Exonic
950460658 3:13120391-13120413 GACACGGGCCAAGTAGGGCAAGG + Intergenic
950465225 3:13149438-13149460 GACAGAGGACAGGCAGGGACAGG + Intergenic
950579671 3:13854009-13854031 GAGACTAGACAGGCAGGGCCTGG + Intronic
952744208 3:36762631-36762653 GACTCAGAACAGGGAGTGCCTGG - Intergenic
953228669 3:41044103-41044125 GAAAAAGGTGAGGTAGGGCCTGG - Intergenic
953759417 3:45674886-45674908 GACAAAGGGCAGGAAGGGGCAGG - Intronic
953960943 3:47265214-47265236 GATACAGGGCAGGGAGGGGCAGG + Intronic
954412749 3:50378137-50378159 GAGACAGAACAGGCAGTGCCTGG - Intronic
958468096 3:94483277-94483299 GACCCAGGGCAGGGAGTGCCAGG + Intergenic
958487164 3:94727554-94727576 GAAACAGGACATGGATGGCCTGG - Intergenic
960096887 3:113697442-113697464 GATCTAGGAGAGGTAGGGCCAGG + Intergenic
961452283 3:127007792-127007814 GACACAGGACAGGCAGCTGCAGG - Exonic
961723207 3:128909426-128909448 GACCCAGGCCTGGGAGGGCCTGG - Intronic
961794880 3:129402373-129402395 GACACAACACAGAGAGGGCCAGG - Intronic
962965595 3:140350899-140350921 TGTACAGGACAGGTAGGGGCAGG - Intronic
964050960 3:152393116-152393138 GAGACAGGCCAGGGAGGGCTGGG - Intronic
968047556 3:195632484-195632506 GACAGAGGAGAGGGAGGGTCGGG + Intergenic
968048573 3:195637956-195637978 GACACAAAACTGGTAGAGCCAGG - Intergenic
968098836 3:195951669-195951691 GACACAAAACTGGTAGAGCCAGG + Intergenic
968103381 3:195984066-195984088 GAGACAGGACACGTAGTGCTGGG - Intergenic
968301688 3:197621658-197621680 GAGACAGGACACGTAGTGCTGGG - Intergenic
968306039 3:197651968-197651990 GACACAAAACTGGTAGAGCCAGG + Intergenic
968307055 3:197657440-197657462 GACAGAGGAGAGGGAGGGTCGGG - Intergenic
968603871 4:1522405-1522427 GACAGAGGACAGGTGGGCCTTGG - Intergenic
968707066 4:2084273-2084295 GCCAGAGAACAGGTAGGGCTGGG - Intronic
969689155 4:8694728-8694750 GACACGGAACAGGGTGGGCCAGG + Intergenic
969982901 4:11177327-11177349 GACACATGACAGGCTGGGCGTGG + Intergenic
973588289 4:52413965-52413987 GTCACAGGAAAGGTAGAGTCTGG + Intergenic
974192408 4:58523079-58523101 GACAAAGGACAGGAAGGGGAGGG - Intergenic
975630916 4:76401320-76401342 GACACAGTACAAGAAGGGCAAGG + Intronic
976233454 4:82870314-82870336 AACACAGGAGAGGTATGGGCAGG - Exonic
977338737 4:95730286-95730308 GGCACAGGATAGGGAGGGGCGGG + Intergenic
977627959 4:99208900-99208922 AACACAGCACAGGTAGAACCTGG + Exonic
977634599 4:99282578-99282600 AACACAGCACAGGTAGAGCCTGG + Exonic
977637289 4:99314053-99314075 AACACAGCACAGGTAGAGCCTGG + Exonic
977639700 4:99343027-99343049 AACACAGCACAGGTAGACCCTGG + Exonic
978744009 4:112171284-112171306 GACACAGTACAAGAAGGGCAAGG + Intronic
979254831 4:118599017-118599039 GACAGAGGAGAGGCAGGGGCAGG - Intergenic
982101139 4:151969066-151969088 GACACAGGATGGGGAGGGACAGG - Intergenic
985170445 4:187143327-187143349 TGCACAGGACAGGCAGGGCAGGG + Intergenic
985498635 5:226070-226092 GAGACAGGACACGTAGTGCTGGG + Intronic
985505051 5:274439-274461 GACACAAAACTGGTAGAGCCAGG - Intronic
985655850 5:1131005-1131027 GACACAGAACAGGGAGGGGGTGG + Intergenic
985743067 5:1631196-1631218 GACACAAAACTGGTAGAGCCAGG + Intergenic
985744061 5:1636680-1636702 GACAGAGGAGAGGGAGGGTCAGG - Intergenic
985760615 5:1746834-1746856 GACACAGACCAGGGAGGGCCGGG + Intergenic
985766990 5:1785325-1785347 GTCACAGGACAGGCAGGGGAGGG - Intergenic
986417651 5:7544950-7544972 GACTCAGGGCAGGTAGGCCCAGG - Intronic
987109603 5:14672763-14672785 GACACAGGACAGGGAAGCCAAGG - Intronic
988355079 5:30163029-30163051 GGCACAGGACAGGGAGGGTGGGG + Intergenic
990200563 5:53367952-53367974 TACACAGGCCTGGTAGGGCTGGG - Intergenic
997853262 5:137351572-137351594 GAAACAGAACTGGGAGGGCCTGG - Intronic
999763061 5:154717626-154717648 AACACAGGACATTTAGGGACAGG + Intronic
1000327283 5:160181983-160182005 GTCAGAGGACAGGAAGGGTCAGG - Intergenic
1000489470 5:161892713-161892735 AACACAGGACAGGCCGGGCACGG + Intronic
1000679180 5:164161434-164161456 CACACAGGACAGGCCGGGCGTGG - Intergenic
1001046070 5:168372755-168372777 GGCACAAGACAGGTGTGGCCAGG - Intronic
1002528994 5:179832589-179832611 GCCACACGGCAGGTGGGGCCAGG - Intronic
1002599881 5:180348022-180348044 CACACAGGACAGGTTGGCTCTGG + Intronic
1002725021 5:181289083-181289105 GACAGAGGAGAGGCAGGGGCAGG - Intergenic
1003398751 6:5774737-5774759 GGGTCAGGACAGGTCGGGCCAGG + Intergenic
1003765713 6:9234128-9234150 GACACAGGAGAAGCAGTGCCAGG + Intergenic
1003979826 6:11379120-11379142 GGCACAGGCCAGGCAGGCCCTGG + Intronic
1007335234 6:41150771-41150793 GATACTGGAATGGTAGGGCCAGG + Intronic
1007967064 6:46013355-46013377 GACACAGTTCAAGTAAGGCCTGG + Intronic
1011798600 6:90983779-90983801 GTCACAGGACCGGGAGTGCCTGG - Intergenic
1017202852 6:151774558-151774580 CACACAGTACTGGTAGGGCTGGG + Intronic
1017720497 6:157240324-157240346 GACACAGGGCTGGGAGGGTCTGG - Intergenic
1019287492 7:231063-231085 GACACAGGCCAGGGTGGTCCAGG + Intronic
1019496874 7:1344878-1344900 GAGACAGGACGGGGAGGGGCTGG + Intergenic
1020073070 7:5240224-5240246 AACACAGGAAAGGCAGGGCGGGG - Intergenic
1020130867 7:5557956-5557978 GGAACAGCACAGGCAGGGCCTGG - Intronic
1020280477 7:6647673-6647695 GGCCCAGGTCAGGTTGGGCCTGG + Intronic
1021028626 7:15701662-15701684 GACACAGTACAAGAAGGGCAAGG - Intergenic
1021068606 7:16209013-16209035 GACACAGGGCAAGAAGGGCAAGG + Intronic
1023927112 7:44677509-44677531 GACACAGAGCAGGGAGGGGCCGG + Intronic
1024069922 7:45776696-45776718 GACAGAGGAGAGGCAGGGGCAGG - Intergenic
1024948515 7:54834826-54834848 GACACAGCAAACATAGGGCCTGG - Intergenic
1026115083 7:67489254-67489276 CACACAGGACAGGATGGGACAGG + Intergenic
1026251772 7:68677503-68677525 GACACAGGACAGGCTGGGCGTGG + Intergenic
1026603997 7:71800346-71800368 GACACAGGCCAGGCAGCCCCAGG - Intronic
1028774060 7:94658183-94658205 GGCCCAGGAGAGGTGGGGCCTGG - Intronic
1029170727 7:98627557-98627579 ACCACAGGACAGCAAGGGCCAGG - Intronic
1029226766 7:99034154-99034176 GAGTCAGGACAGGCTGGGCCAGG + Intronic
1031929169 7:127666799-127666821 GACAGAGGGCGGGAAGGGCCTGG + Intronic
1032047320 7:128620982-128621004 GACAGAGGAGAGGCAGGGGCAGG - Intergenic
1032443665 7:131961843-131961865 GACAGAGCGCAGGCAGGGCCAGG - Intergenic
1032754720 7:134878276-134878298 CACACAGGACAGGCTGGGCATGG + Intronic
1033602170 7:142896375-142896397 GGCACAGGAGAGGCAGGGACTGG - Intergenic
1034187612 7:149191133-149191155 GACACAGTACAAGAAGGGCAAGG - Intergenic
1035010744 7:155713406-155713428 GACACAGGAGGGGGAGGGGCAGG + Intronic
1035756978 8:2041953-2041975 GCCACAGCACAGGGAGGGGCAGG - Intergenic
1035781736 8:2233256-2233278 CACACAGGCCAGGCAGGGACAGG + Intergenic
1036658403 8:10692179-10692201 GACACAGGGCGTGTGGGGCCAGG + Intronic
1036950316 8:13133500-13133522 GACAGAGGAGAGGCGGGGCCTGG - Intronic
1038477625 8:27879299-27879321 GACACAGGACTGGGAAGGGCTGG + Intronic
1038586022 8:28790035-28790057 GACACTGGACAGCAAGGGGCTGG + Intronic
1038614131 8:29077076-29077098 GGCCCAGGACAGCTAGGACCAGG + Intronic
1039297569 8:36173141-36173163 TACACAGGAAAGCTACGGCCTGG + Intergenic
1039596357 8:38793339-38793361 AAAACAGGACAGGCAGGGCTTGG - Intronic
1040514691 8:48125100-48125122 GCCACAAAACAGGTAAGGCCTGG - Intergenic
1040890926 8:52314938-52314960 GACAGTGGACAGAGAGGGCCAGG + Intronic
1040995983 8:53402868-53402890 GACTCATGACAGGTAAGGACTGG + Intergenic
1044021683 8:87112846-87112868 GACATAAGACAGCTAGTGCCAGG - Intronic
1045004138 8:97902721-97902743 GAGACAGGAGAGGTAAGGCAAGG - Intronic
1048393375 8:133989089-133989111 GAGACAGGATGGGTAGGGTCTGG + Intergenic
1049373433 8:142278357-142278379 CTCACAGGACAGGCAGGGGCTGG - Intronic
1049392577 8:142379796-142379818 GACATAGGCCTGGCAGGGCCAGG + Intronic
1049573691 8:143381031-143381053 GACCCAGGACAGGCATGGCTGGG + Intronic
1050106437 9:2171010-2171032 TACACACAACAGGTAGGCCCAGG - Intronic
1051641861 9:19230912-19230934 GGCGCGGGACAGGTAGAGCCCGG + Intronic
1055452127 9:76440567-76440589 GAGACAGGACAGGTGGGTGCAGG - Intronic
1056266588 9:84902709-84902731 GACATAGGGAAGGAAGGGCCAGG - Intronic
1056486614 9:87064559-87064581 GAAAGAGGACAGGGAGTGCCTGG - Intergenic
1057201377 9:93142169-93142191 GCCACAGGACAGGGAGGGAGTGG - Intergenic
1059531201 9:115037139-115037161 GACAGAGCACAGGTAGGGGTGGG - Intronic
1060007740 9:120015337-120015359 GACGCAGGCCAGGTTGGGCCTGG + Intergenic
1060398816 9:123335493-123335515 GGCAGAGGGCAGGTGGGGCCAGG - Intergenic
1060656239 9:125374490-125374512 GACACAGGAGAGGTGTGACCTGG - Intergenic
1061315773 9:129794993-129795015 GAAACAGGACAGGCAGGGATGGG + Intergenic
1061912780 9:133733832-133733854 GGCACACGGCAGGTAGGGACCGG - Exonic
1062750165 9:138246730-138246752 GACAGAGGAGAGGCAGGGGCAGG - Intergenic
1186906693 X:14118820-14118842 GACACAGGAAATGTAAGCCCGGG + Intergenic
1187633167 X:21197333-21197355 GACAGAGGGGAGGAAGGGCCAGG + Intergenic
1189205794 X:39237704-39237726 GACACAGGACAGATAAAGCAAGG - Intergenic
1190220867 X:48511635-48511657 GACACAGAACAGGTAGGACGTGG + Intronic
1194919821 X:99750977-99750999 TGCACAGGACAGTTAGGCCCTGG - Intergenic
1195083431 X:101391524-101391546 GACACAGTACAAGAAGGGCAAGG + Exonic
1195941443 X:110171229-110171251 GACAGAGGGCAGGAAGGGGCTGG + Intronic
1197884596 X:131205110-131205132 AACACAGGATAGGTGGGGCGTGG + Intergenic
1198115997 X:133545150-133545172 GACACTGTACAGCAAGGGCCAGG + Intronic
1199451359 X:147981782-147981804 GAGAGAGGACAGGAAGGGGCAGG - Intronic
1199709725 X:150460594-150460616 GAGGCAGGACTGGCAGGGCCTGG + Intronic
1201465473 Y:14275684-14275706 GACCCAGGACAGGTGTGTCCAGG - Intergenic