ID: 1143367435

View in Genome Browser
Species Human (GRCh38)
Location 17:6417323-6417345
Sequence ATGGAGAAAGAGGCTGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1221
Summary {0: 1, 1: 0, 2: 11, 3: 122, 4: 1087}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143367427_1143367435 8 Left 1143367427 17:6417292-6417314 CCTTTCCATTAAAACCTCAAGCG 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1143367435 17:6417323-6417345 ATGGAGAAAGAGGCTGAGCAAGG 0: 1
1: 0
2: 11
3: 122
4: 1087
1143367433_1143367435 -6 Left 1143367433 17:6417306-6417328 CCTCAAGCGGGAGAGGAATGGAG 0: 1
1: 0
2: 0
3: 10
4: 225
Right 1143367435 17:6417323-6417345 ATGGAGAAAGAGGCTGAGCAAGG 0: 1
1: 0
2: 11
3: 122
4: 1087
1143367430_1143367435 3 Left 1143367430 17:6417297-6417319 CCATTAAAACCTCAAGCGGGAGA 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1143367435 17:6417323-6417345 ATGGAGAAAGAGGCTGAGCAAGG 0: 1
1: 0
2: 11
3: 122
4: 1087
1143367426_1143367435 13 Left 1143367426 17:6417287-6417309 CCTAACCTTTCCATTAAAACCTC 0: 1
1: 0
2: 0
3: 31
4: 389
Right 1143367435 17:6417323-6417345 ATGGAGAAAGAGGCTGAGCAAGG 0: 1
1: 0
2: 11
3: 122
4: 1087

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143367435 Original CRISPR ATGGAGAAAGAGGCTGAGCA AGG Intronic
900288492 1:1913790-1913812 ACAGAAAAAGAGGCTGGGCACGG - Intergenic
900317150 1:2062892-2062914 ATGGAGACAGAGGCTGAGTCTGG - Intronic
900352879 1:2245052-2245074 ATGGGGACAAAGGCTGAGCCTGG - Intronic
900700307 1:4044203-4044225 AAGAAGAAAGAGGCTGGGCACGG - Intergenic
900861469 1:5235777-5235799 AAGTGGAAAGAGGGTGAGCAGGG - Intergenic
901013599 1:6214915-6214937 ATTGAAAAAGAGGCTGGGCGTGG - Intronic
901064216 1:6486960-6486982 ATGGGGAAAGAGGGTGGGAAGGG + Intronic
901280523 1:8030574-8030596 ATGGAAAAATGGGCTGGGCATGG - Intergenic
901567849 1:10133618-10133640 GAGGAGAAAGAGGCCGGGCATGG + Intronic
901669574 1:10848001-10848023 ATGGGCCAAAAGGCTGAGCATGG + Intergenic
901854571 1:12036413-12036435 AAGAAAAAAGAGGCTGGGCATGG + Intergenic
901878755 1:12181721-12181743 ATGGGGGCAGAAGCTGAGCATGG + Intronic
901920941 1:12537204-12537226 AAGGAGAGAGTGGCTGGGCACGG - Intergenic
902357589 1:15916834-15916856 ATGAAGCAGCAGGCTGAGCATGG + Intronic
902429266 1:16350454-16350476 ATAGAAAAGGAGGCTGGGCACGG + Intronic
902441555 1:16433437-16433459 AATGAGAAAGAGGCTGGGGAGGG - Intronic
902464724 1:16608994-16609016 AAGGAAAAATAAGCTGAGCATGG + Intronic
902606507 1:17572268-17572290 ATGGAGCAGGGGGCTGAGGAGGG - Intronic
902630910 1:17704032-17704054 AAGAAGAAAGAGGCCGGGCATGG - Intergenic
902687520 1:18088308-18088330 AATGAGAAAGAGGCTGAGGCAGG + Intergenic
902837500 1:19056650-19056672 AGAGAGAAAGAGGCTGGGCTTGG + Intergenic
903000578 1:20262775-20262797 AGTGAGGAAGAGGCTGGGCACGG - Intergenic
903011070 1:20330786-20330808 ATGCAGAAAGGGACAGAGCATGG - Intronic
903213620 1:21831586-21831608 ATGGCAACAGAGGCTGGGCAAGG + Intronic
903292232 1:22321607-22321629 GGGGAGACAGTGGCTGAGCAGGG - Intergenic
903390745 1:22962055-22962077 AAGGAGACAGAGGCTCAGAAAGG - Intronic
903524645 1:23983897-23983919 AAGAAGAAAGAGGCCGGGCACGG - Intergenic
903539296 1:24087715-24087737 AAGGAGAAAGACATTGAGCAGGG - Intronic
903985329 1:27223419-27223441 ATGATGCTAGAGGCTGAGCACGG - Intergenic
904151843 1:28448223-28448245 TTGGACAAATAGGCTGGGCACGG + Intronic
904195174 1:28780174-28780196 TAGGAGAAACAGGCCGAGCACGG - Intergenic
904677953 1:32209900-32209922 AGGGAGTAAGTGGCTGGGCACGG + Intronic
905133292 1:35777914-35777936 ATGGAGAGAAAGGCTGAGCCTGG - Intergenic
905196493 1:36282214-36282236 AGAGAGAAAGTGGCTGAGCACGG - Intronic
905295536 1:36952055-36952077 ATGCAGAAACAGGGTCAGCAAGG + Intronic
905753213 1:40484487-40484509 AGGCAGAAAAAGGCTGGGCACGG - Intronic
905935622 1:41821803-41821825 ATGTAGACAGAGGCTGCCCAAGG - Intronic
906431848 1:45761565-45761587 ATACAAAAAAAGGCTGAGCACGG - Intergenic
907265777 1:53259887-53259909 AGGGTGAAAGAGGGAGAGCAAGG - Intronic
907755333 1:57305318-57305340 AGGGAGAAAGAAGCTGAAAAGGG + Intronic
907798795 1:57743620-57743642 ATGGAGAACGTGTTTGAGCAGGG + Intronic
907917507 1:58884531-58884553 GTGAAGAAAGGGGCAGAGCAAGG + Intergenic
907963553 1:59307022-59307044 ATGAAGAATGAGGCCAAGCACGG + Intronic
908598437 1:65712282-65712304 AAGGACAAAGGGGCTGGGCACGG - Intergenic
908739717 1:67314752-67314774 ATGGGGAAAGAGGCTGGTCAGGG + Intronic
908772054 1:67606381-67606403 TAAGAGGAAGAGGCTGAGCATGG - Intergenic
908797987 1:67850566-67850588 ATGAAGAAAGAGGCTCAGAGAGG - Intergenic
909205307 1:72749036-72749058 ATGGAAAAAGAGGCAGTGCTGGG + Intergenic
909324465 1:74332588-74332610 ATGGGCAAATAGGCTGGGCATGG - Intronic
909406429 1:75295525-75295547 ATGGAGGAAGAGACTGGGCTGGG + Intronic
910039715 1:82835073-82835095 ATTGAGAAAAAGGCTGAGCGGGG + Intergenic
911063060 1:93764335-93764357 ATGGAGAAAGAGGATGAAGGAGG - Intronic
911313205 1:96323276-96323298 ATAGTCAAAGAGGCTGGGCATGG + Intergenic
911697504 1:100907798-100907820 AGAGAGTAAGAGGCTGAGGAAGG - Intronic
912157335 1:106937911-106937933 ATGGAGAGAAAGACTGAGGATGG - Intergenic
912355188 1:109049091-109049113 ATGTAGAATGAGGCAGGGCACGG - Intergenic
912553432 1:110499151-110499173 ATGGAAACAGAGGCTCAGCAGGG + Intergenic
912643390 1:111368867-111368889 CTGAACCAAGAGGCTGAGCAAGG - Intergenic
913502848 1:119487997-119488019 GTGGAGAAGGAGGAAGAGCAGGG + Intergenic
913511579 1:119567426-119567448 GTAGAGAAACAGGCAGAGCATGG - Intergenic
913515816 1:119604752-119604774 GTAGAGAAACAGGCAGAGCATGG - Intergenic
913576845 1:120183761-120183783 ATGGAGTAAGAGGATGGGCCAGG - Intergenic
914558754 1:148795196-148795218 ATGGAGTAAGAGGATGGGCCAGG - Intergenic
914614079 1:149335034-149335056 ATGGAGTAAGAGGATGGGCCAGG + Intergenic
914988742 1:152480520-152480542 ATGGAGAGAGAGACTGGGAAAGG - Intergenic
915183051 1:154080067-154080089 AAGAAGGAAGAGGCTGGGCATGG + Intronic
915501405 1:156321113-156321135 ATGGACCAAGAGGCAGAACAAGG + Intronic
915507977 1:156369296-156369318 CTGGAGGAAGAGGCACAGCAGGG - Exonic
915614755 1:157028874-157028896 ATGGAGAAACTGGCTGGGCGTGG + Intronic
915802275 1:158807108-158807130 AGAGAGAATGAGGCTGAGGAGGG + Intergenic
916046624 1:161004868-161004890 ATAGATATGGAGGCTGAGCACGG + Intronic
916329982 1:163604576-163604598 ATGGAGAGAGAGGTTGATCCGGG + Intergenic
917444862 1:175098627-175098649 ATGTAGACAGACCCTGAGCATGG - Intronic
917734978 1:177912070-177912092 ATAGAGCTAGAGGCTGGGCACGG + Intergenic
918044325 1:180932352-180932374 ATGGAGAAAGAGGCCCACGAAGG - Intronic
918333601 1:183485154-183485176 ATGCAGAAAGTGGCAGAGCTGGG + Intronic
918345179 1:183601565-183601587 ATGGTGAATCAGGCTGAGCACGG + Intergenic
918413054 1:184280763-184280785 ATTGGGAATGGGGCTGAGCACGG + Intergenic
918491861 1:185089737-185089759 ATGGAGATAGAGGCCGGGCGTGG + Intronic
918930299 1:190846908-190846930 ATGGGCAAATGGGCTGAGCATGG + Intergenic
919467195 1:197936407-197936429 ATCCAGAAGGAGGCTGGGCATGG - Intergenic
919524983 1:198635778-198635800 ATGTAGAAAGAAGCAGAGCCTGG - Intergenic
919682950 1:200454272-200454294 AGGAAGAATGAGGCTGAGGAGGG - Intergenic
919908174 1:202092720-202092742 ATGGAGAAAGAGGTAGACAATGG - Intergenic
920147655 1:203875945-203875967 AGAAAGAAAGAGGCTGGGCATGG - Intergenic
920226834 1:204445300-204445322 ATGTATAAAAAGGCTGGGCATGG + Intronic
920503657 1:206501323-206501345 AGGGAGATAGTGGATGAGCAGGG + Intergenic
920555127 1:206899039-206899061 ATGGAGAAGGAGGAGGTGCAGGG + Intronic
920760548 1:208779973-208779995 AAGGAGACAGTGGCTGGGCATGG - Intergenic
920786417 1:209046451-209046473 TTGCAGAAACAGGCTGGGCACGG - Intergenic
920916725 1:210263679-210263701 GTGGAGAAAGAGCCTTGGCAGGG + Intergenic
921052946 1:211524120-211524142 ATTCAGAAAGAGACTAAGCACGG + Intergenic
921315749 1:213888553-213888575 TTGGAGAAAGAGGAGGAGTAAGG + Intergenic
922107348 1:222523984-222524006 GTGGAGACTGAGGCTTAGCAAGG - Intronic
922434170 1:225586733-225586755 AGGCAGAAAAAGGCCGAGCATGG + Intronic
922463890 1:225833503-225833525 AAAGAGAGAGAGGCTGGGCACGG + Intronic
923079682 1:230641894-230641916 ACGGAGACCGAGGTTGAGCAGGG + Intergenic
923145893 1:231197533-231197555 AAGAAGAAAGAGGCGGGGCACGG + Intronic
923162484 1:231327704-231327726 ATAAGGAAAGAGGCTGGGCATGG - Intergenic
923205547 1:231755329-231755351 AAAGAGAAAGGGGCTGGGCATGG - Intronic
923426342 1:233873432-233873454 ATGGTGAAAGGGGAAGAGCAAGG + Intergenic
923587168 1:235284025-235284047 ATGTAGAATGAGGCTGGGCGTGG - Intronic
923597581 1:235372632-235372654 AGAGAGAGAGAGGCTGGGCACGG + Intronic
923872122 1:238006788-238006810 ATGAAGAGAGAAGCTGGGCACGG - Intergenic
924097705 1:240571401-240571423 ATAGAAAAAGAAGCTGGGCACGG + Intronic
924147267 1:241089164-241089186 ATGGAGGAAAAAGCAGAGCAGGG + Intronic
924308655 1:242718116-242718138 ATGAAGAAAGAGGAGAAGCAAGG + Intergenic
924715539 1:246569716-246569738 TAAGAGAAAGAGGCTGGGCATGG - Intronic
1063451439 10:6152887-6152909 AAGGAAGAAGAGGCTGGGCACGG + Intronic
1063474646 10:6317773-6317795 TTGGAGACAGAGGCTGAGGGTGG + Intergenic
1063595401 10:7430595-7430617 ATGGACATAGCGGCCGAGCACGG + Intergenic
1063858038 10:10276740-10276762 AAGATGAAAGAGGCTGGGCATGG - Intergenic
1064180400 10:13109533-13109555 AAGGAAAAAGAGGCTGGGCGTGG + Intronic
1064211099 10:13361135-13361157 AAGTAGATAGAGGCTGGGCACGG - Intergenic
1064479267 10:15723044-15723066 ATAGAGTGAGAGGCTGGGCATGG + Intergenic
1064529462 10:16292815-16292837 GTGGAGAGAGAGACTGAGAAAGG - Intergenic
1064697078 10:17978033-17978055 ATGGAAAAAGAGTCTGAGGATGG + Exonic
1065077712 10:22097835-22097857 AGGTAGTAAGAGGCTGGGCATGG - Intergenic
1065560728 10:26961470-26961492 ATTGAGCAAGTGGCTGAGCTGGG - Intergenic
1065580375 10:27164926-27164948 AAGGAGACAGTGGCTGGGCACGG - Intronic
1065675822 10:28173148-28173170 AAGGAGAACCAGGGTGAGCAGGG + Intronic
1065784030 10:29196441-29196463 TTGGAGAAAGTGGCTGAGAAGGG - Intergenic
1065955567 10:30690791-30690813 ATGTAGAATGAGGCTGAGGCTGG + Intergenic
1066548423 10:36527262-36527284 ATTAAGAAATAGACTGAGCACGG - Intergenic
1066721163 10:38341024-38341046 CAGGAGAAAGAGGCACAGCATGG - Intergenic
1066991450 10:42518087-42518109 AAGCACAAATAGGCTGAGCATGG - Intergenic
1067067963 10:43114244-43114266 ATGGAGACAGAGGCTCAGAGAGG - Intronic
1067068868 10:43118542-43118564 AGGGAGAAAGAGGGAGAACAGGG - Intronic
1067130732 10:43563022-43563044 ATGAAGAATGAGGCCGGGCACGG + Intronic
1067238622 10:44472153-44472175 ATGCAGAGAGAGGCCGGGCATGG - Intergenic
1067415053 10:46096513-46096535 ATGGAGGAGGAGGCCAAGCAAGG + Intergenic
1067455334 10:46415073-46415095 AGGGAGAAAGTGGCTGGCCAAGG + Intergenic
1067631870 10:47969562-47969584 AGGGAGAAAGTGGCTGGCCAAGG - Intergenic
1067714232 10:48674217-48674239 AAAGAGAGAGAGGCTGGGCACGG - Intergenic
1068604048 10:58986029-58986051 ATGGAGAAAGAGGCAAAGAGAGG + Intergenic
1068874304 10:61980189-61980211 ATGGAGGAAGGGGCTCAGGAGGG + Intronic
1069426064 10:68289633-68289655 AAGGAGAAAGAGACTTAGAAAGG + Intronic
1069935688 10:71914355-71914377 ATGCACAAAGGGGCTGGGCATGG - Intergenic
1069950689 10:72016208-72016230 AGGGAGGAAGAGGCTGGGCGCGG + Intergenic
1070037180 10:72737808-72737830 AAGGGGAAATAGGCTGGGCATGG - Intronic
1070296236 10:75163736-75163758 AGAAAGAAAGAGGCTGGGCATGG - Intronic
1070317480 10:75329035-75329057 ATGGAAAGACAGGCCGAGCACGG - Intergenic
1071230119 10:83576633-83576655 ATGGCAAAGGAGGCTGGGCACGG - Intergenic
1071339020 10:84625514-84625536 ATGCAAAGAGAGGCTGAGGAAGG - Intergenic
1071473576 10:86005406-86005428 AAGGAGAAAGATCATGAGCAAGG + Intronic
1072085638 10:92076794-92076816 AAGGAGAAAGAGGAGGAGGAGGG + Intronic
1072351107 10:94558368-94558390 ATGGAGAAAGAGCCAAAGTATGG + Intronic
1072390097 10:94974839-94974861 GTGGAGAATGAGGCTGAAAAAGG + Intronic
1072798879 10:98377964-98377986 ATGAAGAAAGAGGGTAAGGAAGG - Intergenic
1073045625 10:100636243-100636265 CTGTTGAAAGATGCTGAGCAAGG - Intergenic
1073308792 10:102524609-102524631 AAGAAGAAATAGGCTGGGCACGG - Intronic
1073352775 10:102831662-102831684 AGGGGGCATGAGGCTGAGCAAGG - Intronic
1073867875 10:107825696-107825718 ATAGTGAAGGAGGCTGAGCCTGG + Intergenic
1073879508 10:107964357-107964379 AAAGATAAAGAAGCTGAGCATGG - Intergenic
1073961996 10:108942647-108942669 ATTGAGAAAGAGGCTGAAGACGG - Intergenic
1074009224 10:109459346-109459368 ATGGATAAAGAGGCTGGGTGTGG - Intergenic
1074317520 10:112372946-112372968 GTGGAAAGAGAGGCTGGGCATGG + Intergenic
1074493071 10:113956054-113956076 CTGGAGACAGAGGCAGAGAATGG - Intergenic
1074609917 10:115011727-115011749 ATGGGACAAGAGGCTGGGCACGG + Intergenic
1074715480 10:116214522-116214544 ATGGAGTTAAAGGCTGAGCCAGG + Intronic
1074749616 10:116572310-116572332 ATGTTGAAAGAGGCCGGGCACGG + Intergenic
1074997830 10:118773111-118773133 AAGAAGAGAGAGGCTGGGCATGG - Intergenic
1075010982 10:118869928-118869950 ATATAGAAATTGGCTGAGCATGG + Intergenic
1075060684 10:119254762-119254784 ATGGAAAAACAGGCCGGGCACGG + Intronic
1075568970 10:123525210-123525232 AAGGATAAAGAGGCTGGGCACGG - Intergenic
1075759159 10:124842244-124842266 ATGTATAAAGAGGCTGGGCACGG + Intergenic
1075759581 10:124845907-124845929 CTGGAGAATGAGGATGAGGATGG - Intergenic
1076002526 10:126923691-126923713 ATGGAGAGAGATGCCGAGAATGG - Intronic
1076150318 10:128157064-128157086 ATCGGAAAACAGGCTGAGCATGG - Intergenic
1076166088 10:128284049-128284071 GTACAGAAAGAGGCTGGGCATGG + Intergenic
1076602724 10:131669484-131669506 AGGGAGAGAGAGGGAGAGCAAGG + Intergenic
1077345094 11:2044036-2044058 ATGGATAAAGGAGCTGGGCATGG - Intergenic
1077523294 11:3049052-3049074 GAGGAGAAGGAGGGTGAGCAGGG - Intronic
1077652189 11:3983222-3983244 ATGGAGATAGAGGCAGGGCATGG - Intronic
1077652316 11:3984154-3984176 AAGGAGAAAGAGGCTGGACACGG - Intronic
1078553352 11:12295428-12295450 AAAAAAAAAGAGGCTGAGCATGG - Intronic
1078720286 11:13877832-13877854 ATGGAGTCAGAGTGTGAGCAGGG + Intergenic
1079331301 11:19535217-19535239 ATGGAAAGAGAGGCAGAGAAGGG + Intronic
1079932104 11:26577271-26577293 AGAGAGAAAGTGGCTGGGCATGG + Intronic
1080427300 11:32168032-32168054 ATGTATAATGAGGCTGAGAAAGG + Intergenic
1080930454 11:36804815-36804837 CTGGGGAAAGAGTCTGAGAAAGG + Intergenic
1081342021 11:41939932-41939954 TTGGAGAGAGAGACAGAGCAGGG + Intergenic
1081414299 11:42795903-42795925 ATTGAAAAAGTAGCTGAGCATGG - Intergenic
1081982581 11:47277585-47277607 ATGTAGAAAGAGGCTGGGCACGG - Intronic
1081985762 11:47302500-47302522 AACTAAAAAGAGGCTGAGCACGG - Intronic
1082016328 11:47491151-47491173 ATAAAGAAATAGGCTGGGCACGG - Intronic
1082040515 11:47681037-47681059 AAGGAAAATGAGGCTGGGCATGG + Intronic
1082093420 11:48107790-48107812 TTGGAGAAAAAAGCTGGGCATGG + Intronic
1082806496 11:57454984-57455006 ATGGAGAAACAGGCTCAGAGAGG - Intergenic
1083251245 11:61468826-61468848 ATGGACAATGTGGCTGGGCATGG + Intronic
1083463877 11:62832680-62832702 AAGGAGGAAGAGTCTGAGGACGG - Intronic
1083482393 11:62957986-62958008 AAGAAGAAAGAGGCTGGGCGCGG - Intronic
1083575639 11:63789098-63789120 AAGAAGAAAGAGGCTGGGCACGG + Intergenic
1083757402 11:64799126-64799148 TGGGAAAACGAGGCTGAGCAGGG + Intronic
1083791600 11:64989539-64989561 CTGGAGAGAGCGGCTGAGCTGGG + Exonic
1083841902 11:65309349-65309371 ATGGAGAAACACCCAGAGCAGGG - Intergenic
1084144707 11:67258787-67258809 CTGCAGAAAGTAGCTGAGCAGGG + Intergenic
1084726613 11:70946294-70946316 GTGGAGAGAGAGGTTGAGCCTGG - Intronic
1084726735 11:70946769-70946791 GTGGAGAGAGAGGTTGAGCCTGG - Intronic
1084912354 11:72401037-72401059 ATGAAGAAACAGGCTGTCCATGG + Intronic
1084970903 11:72771636-72771658 AGGGGGAAAGAGGCAGAGCAGGG - Intronic
1085081792 11:73641073-73641095 AAGAATAAAGAGGCTGGGCATGG + Intergenic
1085327726 11:75620177-75620199 AGAGAAAAAGAGGCTGGGCATGG + Intronic
1086074244 11:82833362-82833384 ATGGAAAAAGAGGATGAGAAAGG + Intronic
1086631798 11:89028482-89028504 ACTGAGAAAGAGGCTGAGACAGG + Intronic
1086957761 11:92951222-92951244 ATGGAGAGACAGGCTGGGCATGG + Intergenic
1086985523 11:93244819-93244841 GTGGAGAGGGAGGCTGAGGAGGG - Intergenic
1087092555 11:94288729-94288751 CTGGAGAAAGAGGTGGAGAATGG + Intergenic
1087261564 11:96017998-96018020 ACGGAGAAAGAAGATGAGTAAGG + Intronic
1087292747 11:96338374-96338396 ATGAAGAAACTGGCTGAGTAAGG + Intronic
1087392962 11:97562308-97562330 ATGGGCAAATGGGCTGAGCATGG + Intergenic
1087784422 11:102338863-102338885 AGGGAGAATGAGGCTGAGACAGG + Intronic
1088242153 11:107783888-107783910 ATGAAGAAAGGGGCCGGGCACGG + Intergenic
1088668204 11:112115801-112115823 AGGGAGAAAGGGGCTGGGGATGG + Intronic
1089399322 11:118155353-118155375 ATGAAGAAAGAGGCTCAGAGAGG + Intergenic
1089597108 11:119587454-119587476 ACAGAAAAAGAGGCTGGGCATGG + Intergenic
1089773732 11:120821437-120821459 ATGGAAAGAGAGGCTGGGGAAGG + Intronic
1089791378 11:120947111-120947133 AGGGAGAAATAGGCTGGGCACGG + Intronic
1089811750 11:121137876-121137898 TTGGGGAAAGAGTCTGAGCTTGG - Exonic
1090193536 11:124795167-124795189 ATGGTAAAAGAGGCCGGGCATGG - Intronic
1090568205 11:128018959-128018981 TTGGAGAAAGAGCCTGAGCATGG - Intergenic
1090921226 11:131207523-131207545 ATGGTGGAAGAGGCTGAACATGG - Intergenic
1090983840 11:131748571-131748593 ATGGAGTAAGAGGCAGTGGATGG - Intronic
1091126638 11:133105688-133105710 AAAGAAAAAGAGGCTGGGCACGG + Intronic
1202828023 11_KI270721v1_random:98908-98930 ATGGATAAAGGAGCTGGGCATGG - Intergenic
1091538316 12:1434811-1434833 ATGACGAAAGAGGCTCAGCATGG - Intronic
1091642111 12:2245288-2245310 ATGGAGAATGGAGCTGAGAATGG - Intronic
1092050828 12:5468828-5468850 ACAGAGAAAGCGGCTGGGCATGG + Intronic
1092078880 12:5697141-5697163 ATTGAAAAGGAGGCTGGGCATGG + Intronic
1092216070 12:6683726-6683748 AGGAAGGAGGAGGCTGAGCACGG + Intronic
1092370185 12:7910413-7910435 ATGGATAAACAGGCTGGGCGCGG + Intergenic
1092710487 12:11331651-11331673 AGGGATAAAGAGGTAGAGCAAGG - Intergenic
1093317432 12:17668297-17668319 ATGAAGTAAGAGGCAGGGCATGG + Intergenic
1093755020 12:22842496-22842518 TAGCAGAAAGAGGCTGGGCATGG - Intergenic
1094036661 12:26079292-26079314 ATGGTCAAAGGGGCTGGGCATGG + Intronic
1095610521 12:44122332-44122354 AAAGAAAAAGAGGCTGGGCATGG - Intronic
1096402604 12:51319620-51319642 AAGGAGAAAGAGCAAGAGCAAGG + Intronic
1096502369 12:52072244-52072266 ATGGAGCAAGTGGCAGAGCTGGG + Intronic
1096652098 12:53066820-53066842 ATGGAGAGAGAGGCCGGGCGCGG + Intronic
1096685764 12:53287361-53287383 AAAAAAAAAGAGGCTGAGCATGG - Intronic
1097154899 12:57005869-57005891 ATGGAGAAAGGGGCTGTGTTGGG - Intronic
1097188048 12:57206086-57206108 ATGGAGCACGAGGGTGTGCATGG - Intronic
1097726218 12:63078539-63078561 ATGGAAATAGAGGCCGGGCATGG + Intergenic
1098215749 12:68215972-68215994 AAAGATAAATAGGCTGAGCATGG - Intronic
1098959446 12:76724254-76724276 GTGTAGAAAGAGGCTGGGCGTGG + Intergenic
1099356349 12:81640492-81640514 ATGGAGCAAAAGTCTGTGCAAGG - Intronic
1100475773 12:94934066-94934088 ATAGACAATTAGGCTGAGCATGG - Intronic
1100715438 12:97300919-97300941 ACTGAGAAAGAGGCTGAACCTGG - Intergenic
1101325924 12:103715957-103715979 TGAGAGAAAGAGGCTGAGAACGG + Intronic
1101846668 12:108368358-108368380 ATGGAGAAACAGGCCCAGAAGGG + Intergenic
1101918454 12:108913939-108913961 ATGAAGAAATGGGCTGGGCATGG - Intronic
1102442049 12:112970976-112970998 AGAGAGAAACAGGCTGAGCACGG - Exonic
1102500309 12:113347568-113347590 AAGGAGAAAGGGGCTGGTCATGG + Intronic
1102730747 12:115106691-115106713 ATGGAGAGTGAGGGTGAGCCTGG - Intergenic
1102746865 12:115256610-115256632 ATGCAAAAACAGGTTGAGCAGGG + Intergenic
1102747807 12:115265319-115265341 TTGCAGAAAGAAGATGAGCATGG + Intergenic
1102754013 12:115321978-115322000 ATAGATAAATGGGCTGAGCACGG - Intergenic
1102807961 12:115798829-115798851 AGTGAGACAGAGGCTGGGCATGG + Intergenic
1103040381 12:117690271-117690293 ATGGGGAAAAAGGCCGGGCACGG + Intronic
1103100567 12:118170814-118170836 ATGCAGAAAGAGCCTGAGCCTGG + Intronic
1103293678 12:119867887-119867909 ATGGAGGAAGGGGCTGAGGAAGG - Intronic
1103490864 12:121318728-121318750 TTGTTGAAAGAGGCTGAGCGCGG + Intronic
1103941089 12:124501582-124501604 GTGGAGATAGAGGCAGAGGATGG - Intronic
1103949202 12:124542103-124542125 ATGCAGGAAGAGGCTGAGGCTGG - Intronic
1104550045 12:129748347-129748369 ACGGAGAATGAGACTGAGGAGGG + Intronic
1105399231 13:20073196-20073218 ATACAAAAAGAGGCTGGGCATGG - Intronic
1105448123 13:20475003-20475025 AGGGTGAAGGAGGCTGCGCACGG - Intronic
1105494128 13:20915611-20915633 ATGGACAAAGGGGCTGAGCACGG + Intergenic
1105549521 13:21380103-21380125 AAGGAAAAAAAGGCTGGGCACGG - Intronic
1105790181 13:23790903-23790925 ATGGAGTGAGAGGCTGAGTTAGG - Intronic
1106547813 13:30745453-30745475 ATGGAGAAAGAGGGAGATCTAGG - Intronic
1106704311 13:32264620-32264642 ATGGAAAAAGAGGCTGGGTTTGG - Intronic
1106762176 13:32878098-32878120 GTGGAGACAGAGGCTATGCATGG + Intergenic
1106825233 13:33513246-33513268 AAAGAGAGAGGGGCTGAGCAAGG - Intergenic
1107021776 13:35759610-35759632 GTAGAGAAGGAGGCTGAGGAAGG - Intergenic
1107031035 13:35853971-35853993 ATGGAGAATTTGGCTGAGCTTGG - Intronic
1107190625 13:37580651-37580673 ATGGAGAAAGGGAGTAAGCAAGG - Exonic
1107491425 13:40883311-40883333 ACTGAGAAAGAGGCCGGGCATGG - Intergenic
1107708550 13:43130918-43130940 CTGAGGAAAGAGGCTGAGCAGGG + Intergenic
1108393899 13:49974432-49974454 ATGGAGAAACAGGCCGGGTACGG - Intergenic
1108931860 13:55835122-55835144 ATCTAAAAAGAGGCTGGGCAGGG + Intergenic
1109977231 13:69854337-69854359 ATGAAGAAAGAGAGAGAGCATGG + Intronic
1110075817 13:71241070-71241092 TTTGAGACATAGGCTGAGCATGG + Intergenic
1110438808 13:75504968-75504990 AGAGAGAAAGAGGCCGGGCACGG - Intergenic
1110457494 13:75706167-75706189 AGGTAGAAAGTGGCAGAGCAGGG + Intronic
1110520476 13:76470059-76470081 ATGGATAATGAGGCCGGGCACGG - Intergenic
1110568275 13:76977920-76977942 ATGCAGATACAGGCTGGGCATGG + Intergenic
1111056783 13:82961005-82961027 ATATAGTATGAGGCTGAGCAGGG - Intergenic
1111166373 13:84462942-84462964 AAGGAGAAGGAGACTGATCAAGG - Intergenic
1111703765 13:91722605-91722627 AAGGAGGAAGAGGCAGAGGAAGG - Intronic
1111955606 13:94753993-94754015 ATTAAGAAATAGGCTGGGCATGG - Intergenic
1112328537 13:98459882-98459904 TGGGAGGGAGAGGCTGAGCAGGG + Intronic
1112669212 13:101615153-101615175 GTGAAGAGAGAGGCAGAGCAGGG - Intronic
1112806793 13:103171918-103171940 AAGGAGACTGAGGCAGAGCACGG - Intergenic
1113015436 13:105823418-105823440 GTGGAGAAGGAGGCCGTGCAGGG - Intergenic
1113401394 13:109997326-109997348 ATTTTGAAAGAGGCTGAGCCAGG + Intergenic
1113672225 13:112183052-112183074 GTGGAGAAGGAGGCTGACGATGG - Intergenic
1114188151 14:20419298-20419320 ATGAAGAAAGAGGTCGGGCATGG - Intergenic
1115402978 14:32984250-32984272 ATGGAGTTAGAAGCAGAGCAAGG + Intronic
1115583697 14:34788290-34788312 AAGAAAAATGAGGCTGAGCATGG - Intronic
1115637021 14:35299610-35299632 AAGAAAAAAGAGGCTGGGCATGG - Intronic
1116039953 14:39674003-39674025 ATGGAGTAGTAGGATGAGCATGG - Intergenic
1116251982 14:42498133-42498155 AAAGAGAGAGAGGCTGAGAAAGG - Intergenic
1116838264 14:49792500-49792522 ATGGAGATTGTGGCTGGGCACGG - Intronic
1116843285 14:49841282-49841304 ATTGAGAAAGAAGCCGGGCATGG + Intronic
1117531184 14:56661891-56661913 GGGGAGAAAGAGGCAGAGAATGG + Intronic
1117707671 14:58488666-58488688 CTGGAGGTGGAGGCTGAGCAGGG - Exonic
1118262252 14:64258458-64258480 AGCTAGAAAGAGGCTGAGCTGGG - Intronic
1118302022 14:64624730-64624752 ATCAAGCAAGAGGCTGAGCGTGG + Intergenic
1118636977 14:67756961-67756983 ATGGAGACACAGACTGAGAAAGG - Intronic
1118809450 14:69262198-69262220 GCGGAGAAAGAGGCTGGGCAGGG + Intronic
1118850297 14:69577914-69577936 ATGTAGAAATTGGCTGGGCACGG + Intergenic
1118860073 14:69656109-69656131 ATGGAGGAAGAGGAAGAGGAAGG - Intronic
1119103772 14:71905148-71905170 ATGGAAAAAGAAACTGATCAAGG - Intergenic
1119400902 14:74361572-74361594 ATGGAGCAAGAGGCAGAGTCAGG - Intergenic
1119473602 14:74914069-74914091 ATGGAGAAACAGGCTCAGGAGGG - Intronic
1119844526 14:77818570-77818592 AAGCAGAGAGAGGCTGAGCATGG - Intronic
1119859913 14:77928748-77928770 ATGCAAAAACAGGCTGGGCACGG - Intronic
1120026046 14:79585394-79585416 TTTGATAAAGAGGCTGGGCACGG + Intronic
1120461239 14:84799009-84799031 CTAAAGAAAGGGGCTGAGCAGGG + Intergenic
1121097360 14:91226967-91226989 ATTGAGAAGGAGGCTGGGCATGG + Intergenic
1121144712 14:91573990-91574012 AGAGAGAAAGAGGCTGGGCAGGG + Intergenic
1121171097 14:91855084-91855106 ATGAAGAAACAAGTTGAGCAGGG + Intronic
1121571408 14:94949372-94949394 AAGGTAAAAGAGGCTGGGCATGG - Intergenic
1121571953 14:94952861-94952883 AAGGTAAAAGAGGCTGGGCATGG - Intergenic
1121670616 14:95708182-95708204 ATGTAGAGGGAGGCTGGGCACGG + Intergenic
1121813007 14:96907939-96907961 ATGGAGAAAAAGGCACATCATGG + Intronic
1122014984 14:98787665-98787687 ATGGAGAGTGGGGCTGGGCATGG - Intergenic
1122020945 14:98837448-98837470 GTGGAGAAAGAGTGTGAGCCTGG - Intergenic
1122045205 14:99018009-99018031 ATGAGGAAACAGGCTCAGCAAGG - Intergenic
1122213469 14:100188253-100188275 CTGCAGAATGAGGCTGGGCACGG - Intergenic
1122322264 14:100862170-100862192 AGGGAGAAAGAGGAGGAGGAGGG - Intergenic
1122338958 14:101013075-101013097 AGGAAGAGAGAGGCTGGGCACGG - Intergenic
1122359663 14:101151768-101151790 ATGGAGCAAGAGCCTGTGCCCGG + Intergenic
1122385724 14:101345280-101345302 ATGTAGCAAAAGGCTGGGCATGG + Intergenic
1122636351 14:103131585-103131607 ATGGGGCTATAGGCTGAGCAGGG + Intronic
1122734765 14:103831599-103831621 AAGGCAAAAGAGGCCGAGCATGG - Intronic
1122919294 14:104873477-104873499 GTGGAGAGAGAGGCTGACCGAGG + Intronic
1123116614 14:105897695-105897717 ATGCAGGCAGAGCCTGAGCAGGG - Intergenic
1123403614 15:20008143-20008165 ATGCAGGCAGAGCCTGAGCAGGG - Intergenic
1123512950 15:21014788-21014810 ATGCAGGCAGAGCCTGAGCAGGG - Intergenic
1123699872 15:22906396-22906418 ATCCAGAAATAGGCTGGGCACGG - Intronic
1123828935 15:24113698-24113720 ATGAAGAATGAGGCTGGGCATGG + Intergenic
1123863567 15:24493807-24493829 ATGAAGAGTGAGGCTGGGCATGG + Intergenic
1124620290 15:31270166-31270188 AAAGAGAAAGAGAGTGAGCAGGG + Intergenic
1124816636 15:33000532-33000554 TTGGAGAGAGAGGCTGAGGTGGG + Intronic
1125847773 15:42873914-42873936 GTGGAGAAAGAGGTAGAACATGG - Intronic
1126326112 15:47479333-47479355 ATAGAGAAACAGGTTGAGGATGG - Intronic
1126632302 15:50749574-50749596 GTGAAGAAGGAGGCTGGGCACGG - Intronic
1126672287 15:51127347-51127369 GTGGTGAAAGAGGCTGAGAGTGG - Intergenic
1127267844 15:57376089-57376111 AGGGGGAAAAAGGCTAAGCAGGG + Intronic
1127279831 15:57479371-57479393 ATGGGCAAAGGGGCTGGGCATGG + Intronic
1127533566 15:59868540-59868562 ATGGAGAAAGAAGGAGAGAAAGG - Intergenic
1127660434 15:61095581-61095603 ATGGAGAATGAGGTTGTGCAAGG + Intronic
1128044032 15:64601223-64601245 ATGGACGATGAGGCTGAGGAAGG + Intronic
1128084103 15:64874103-64874125 AGGGAGAAAGGGGCCGGGCACGG - Intronic
1128419483 15:67478092-67478114 AGGCAGACAGAGGCTGGGCACGG + Intronic
1128465133 15:67904241-67904263 ATGCAGAAATTGGCTGGGCATGG - Intergenic
1128521077 15:68375357-68375379 ATGGAGAGAGAGGGAGAGAAAGG - Intronic
1128576879 15:68782360-68782382 ATGAAGAAATAGGCTCAGAAAGG + Intronic
1128705869 15:69837095-69837117 ATGGAGACTGAGGCTCAGAAAGG + Intergenic
1128724449 15:69977652-69977674 ATGGAGAAAGGAGCTGAGGTTGG + Intergenic
1128870406 15:71151054-71151076 ATGGAGAAAAGGGCTGGGCTGGG + Intronic
1129702013 15:77773634-77773656 CTGGAGACAGAAGCTGACCAAGG + Intronic
1129928210 15:79385014-79385036 ATGGAGAATGAAGAAGAGCAAGG + Intronic
1130069662 15:80635780-80635802 ATGGGGAAAGAAGATGTGCAAGG + Intergenic
1130572287 15:85057506-85057528 ATGGAGCATGAGCCAGAGCAGGG - Intronic
1130900342 15:88202260-88202282 AAGTTGAAAGAGCCTGAGCAAGG - Intronic
1131108424 15:89749967-89749989 ATGGAGGGAGGGGCTGAGAAGGG + Exonic
1131212345 15:90508693-90508715 ATGAAATAAGAGGCTGGGCATGG - Intergenic
1131721931 15:95178926-95178948 ATATAGAAAGAGGCTGGGCATGG - Intergenic
1131898578 15:97062110-97062132 AAAGAGAAAGTGACTGAGCATGG + Intergenic
1132247222 15:100306955-100306977 AAGGAGAACGAGGCTGAGAGAGG + Intronic
1132943882 16:2521481-2521503 AGGGAGGAAGAGCCTGACCAGGG - Intronic
1133013132 16:2925721-2925743 ATGGAGGAACAGGCTGGGCCGGG + Intronic
1133065084 16:3200317-3200339 ATGAGGAAAAAGGCTGGGCATGG + Intergenic
1133100410 16:3475938-3475960 ATGGGGAGAGAGGCTGGCCAGGG + Intronic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133175357 16:4010310-4010332 AAGCTGAGAGAGGCTGAGCAGGG + Intronic
1133592933 16:7263605-7263627 AGGTAGAAAGAGGCTGGGAACGG + Intronic
1133757311 16:8771757-8771779 AAAAAGAAAGAGGCTGGGCATGG - Intronic
1134174448 16:11994465-11994487 ATGGAGGTCGAGGGTGAGCAGGG + Intronic
1134316831 16:13126646-13126668 GTGGAGAGAGAGACTGAGGAAGG + Intronic
1134450402 16:14359802-14359824 ATGGAGAAAGAAGCCAGGCAGGG - Intergenic
1134850888 16:17477942-17477964 AAATAAAAAGAGGCTGAGCATGG + Intergenic
1134856043 16:17520118-17520140 ATGGAGAAGGAGGCAGGGGAAGG + Intergenic
1135086989 16:19483149-19483171 ATAAATAAATAGGCTGAGCATGG - Intronic
1135647336 16:24174630-24174652 CTGAAGAAAGAGGCAGGGCAGGG - Intronic
1135827058 16:25738223-25738245 TAGGAGACAGAGGATGAGCAAGG - Intronic
1135861259 16:26058212-26058234 TTGGAGAAAGGGGCTGAGCCAGG + Intronic
1135900495 16:26455038-26455060 AAGGATAACAAGGCTGAGCAGGG + Intergenic
1136316752 16:29459012-29459034 AACAAGAAAGAGGCTGAGCGTGG - Intergenic
1136363315 16:29795978-29796000 ATGGAGGTACAGGCTGGGCAGGG + Intronic
1136392953 16:29976923-29976945 ATAAAGAAACAGGCTCAGCAAGG - Intronic
1136431327 16:30198354-30198376 AACAAGAAAGAGGCTGAGCGTGG - Intronic
1136490322 16:30603874-30603896 ATGGAGGAAGAGGCAGAGTAGGG + Exonic
1136513044 16:30750852-30750874 ATGGAGGAAGTGGCAGAGCCTGG + Intronic
1136518328 16:30781189-30781211 ATGGAGGAAGATGCTCAGCTGGG - Exonic
1136558584 16:31024734-31024756 ATGGTAGAAGAGGCTGGGCACGG - Intergenic
1137038070 16:35583967-35583989 AAGGAGGATGAGGCTGGGCATGG + Intergenic
1137287408 16:47027636-47027658 TTAAAGAAAGAGGCTGACCACGG - Intergenic
1137314825 16:47306802-47306824 ACGGAGAAAGAGGCCGGGCGCGG + Intronic
1138121507 16:54404183-54404205 ATGGAGGAAGAGGCTTACAAGGG + Intergenic
1138488403 16:57361483-57361505 ATGGAGAAACAGGCTTAGCAAGG + Intronic
1138498161 16:57421316-57421338 ATGGAGAAATAGGCTCAGGCAGG - Intergenic
1138607189 16:58096960-58096982 CTGGAGGAAAAGGCTGAGCCGGG + Intergenic
1139089587 16:63629164-63629186 AGGGACAATGAGGCTGAGCAGGG + Intergenic
1139212947 16:65098654-65098676 ATGAAGACAGAGGCAGGGCATGG - Intronic
1139321944 16:66121916-66121938 ATGGAGACAGAGGATAACCAAGG - Intergenic
1139495489 16:67314145-67314167 AGGGAGAGAGGGGCTGGGCACGG - Intronic
1139536712 16:67580079-67580101 ATGGAGCAAGAGGGGAAGCAGGG + Intronic
1139605169 16:68013110-68013132 AGGAAGAAAGAGGCTGGGTATGG + Intronic
1139656855 16:68393112-68393134 ATGGACCAGGAGGCTGGGCATGG + Intronic
1139718715 16:68835619-68835641 GTGGAGAAAGAGGCCGGGCGCGG + Intergenic
1140350881 16:74261031-74261053 ATGGAGAGAGAGGCTGGGTCAGG - Intergenic
1140976271 16:80062906-80062928 AAGAAGGAAGAGGCTGGGCACGG - Intergenic
1140985940 16:80158011-80158033 ATGGAGACAGGGACTGAGCCAGG + Intergenic
1141000450 16:80302666-80302688 ATGGACAAGCAGGCTGGGCATGG - Intergenic
1141104098 16:81218994-81219016 ATGGACAAGGAGGCTGGGCGTGG - Intergenic
1141550855 16:84805833-84805855 AGAGAGACTGAGGCTGAGCATGG + Intergenic
1141623301 16:85248493-85248515 AGGGAGGAAGAGGCAGAGAAAGG - Intergenic
1141801472 16:86312324-86312346 AAAGAGATAGAGGCTGAGCACGG - Intergenic
1141985523 16:87577293-87577315 TTGGAGAAAGAGGCTGGGCGTGG - Intergenic
1142394224 16:89822390-89822412 ACCGACACAGAGGCTGAGCATGG - Intronic
1142523067 17:518611-518633 ATGGAGGAAGGGGCTGGGCTCGG + Exonic
1142607980 17:1092466-1092488 ATTGAGAAAGAGTCTGAGACTGG - Intronic
1142783054 17:2196739-2196761 ATGAAGAAAGGGGCCGGGCATGG + Intronic
1142913952 17:3118361-3118383 AAAGAGACAGAGGCTGGGCATGG + Intergenic
1143049071 17:4107752-4107774 ATAAAGAAATAGGCTGGGCATGG + Intronic
1143164292 17:4890160-4890182 AAGGAGGAAGAGGCAGAGGAGGG - Intronic
1143367435 17:6417323-6417345 ATGGAGAAAGAGGCTGAGCAAGG + Intronic
1143579533 17:7817579-7817601 ATGGCGAAAGAAGGGGAGCAAGG - Exonic
1144583808 17:16475754-16475776 TTGTAGAAACGGGCTGAGCACGG + Intronic
1144753018 17:17663103-17663125 AGGGGGAAACAGGCTGAGAAAGG + Intergenic
1144864296 17:18324950-18324972 CTGGAGGCAGAGGCTGTGCAGGG + Intergenic
1145084686 17:19927506-19927528 ATGGGCAAAGGGGCTGAGCAAGG + Intronic
1146174714 17:30658421-30658443 AAAAAGAAAGAGGCTGGGCACGG + Intergenic
1146348174 17:32074432-32074454 AAAAAGAAAGAGGCTGGGCACGG + Intergenic
1146610243 17:34298653-34298675 AGGAAGAAAAAGGCTGAGCATGG - Intergenic
1146742552 17:35299223-35299245 ATGGAGAAGGAGAAGGAGCAGGG - Intergenic
1146853007 17:36239587-36239609 AAGGAAAAAGAGGCTGAGAATGG + Intronic
1146868916 17:36363467-36363489 AAGGAAAAAGAGGCTGAGAATGG + Intronic
1147071791 17:37964099-37964121 AAGGAAAAAGAGGCTGAGAATGG + Intergenic
1147083318 17:38043625-38043647 AAGGAAAAAGAGGCTGAGAATGG + Intronic
1147099262 17:38167599-38167621 AAGGAAAAAGAGGCTGAGAATGG + Intergenic
1147256707 17:39186035-39186057 GAGGAGGAAGAGGCTGAGCTTGG - Intronic
1147344187 17:39776811-39776833 TTGGAAAAAGAGGCTGAGACAGG + Intronic
1147513781 17:41097090-41097112 AGGGAGAAAGCGGGAGAGCACGG + Exonic
1147551975 17:41449547-41449569 ATGGAGAGAGATGCTGACAAGGG - Intergenic
1147744113 17:42684623-42684645 ATGGAGAAAGAAGCAGAGGGGGG + Intronic
1147846186 17:43405437-43405459 ATGAAGAAACTGGCTGGGCACGG + Intergenic
1148067598 17:44883974-44883996 AAGGAAGAAGAGGCTGGGCATGG + Intronic
1148823411 17:50374527-50374549 ATTGAGATATAGGCTGGGCATGG - Intronic
1148880801 17:50725046-50725068 ATGAAGAGAAAGGCTGGGCATGG - Intronic
1149546289 17:57506214-57506236 AAAGAGAAAGAGCCGGAGCAGGG - Intronic
1150082282 17:62250897-62250919 AAGGAAAAAGAGGCTGAGAATGG + Intergenic
1150118338 17:62575850-62575872 AAGAAGAAAGAAGCTGGGCATGG - Intronic
1150225336 17:63521718-63521740 ATAGACAAGGAGGCTCAGCAAGG - Intronic
1150304253 17:64071065-64071087 AAGAAGAAAGAGGCTGAAAAGGG + Intronic
1150493615 17:65591195-65591217 ATAGAGACAGAGGCCGGGCATGG + Intronic
1151122747 17:71810603-71810625 AAGGATAAGGAGGCTGGGCATGG + Intergenic
1151229485 17:72673391-72673413 ATAGAGAAAGAGGCCGGGCACGG - Intronic
1151276991 17:73042508-73042530 AATCAGAAAGAGGCTGGGCATGG + Intronic
1151404500 17:73877875-73877897 ATGGAGACAAAGGATGACCAGGG - Intergenic
1151571211 17:74926457-74926479 ACAGAGGAAGAGGATGAGCAGGG + Intronic
1151759655 17:76093369-76093391 TTGGAGAAACAGGCAGAGCAGGG - Intronic
1152090629 17:78245099-78245121 AAGAATAAAGAGGCTGGGCATGG - Intergenic
1152218381 17:79047580-79047602 ATGGCAAAACAGGCTCAGCAGGG + Exonic
1152261227 17:79268417-79268439 TTGGAGGAAGGGGCTGAGCTTGG - Intronic
1153021889 18:636915-636937 AAGGAGAAAGGGGCTGGGCATGG - Intronic
1153247711 18:3089737-3089759 ATGAAGAAATAGGCTTAGGAAGG + Intronic
1153795577 18:8618800-8618822 AAAGAGAATGTGGCTGAGCACGG - Intronic
1154073141 18:11173509-11173531 ATAGAGAAAAAGGCTGGGCACGG + Intergenic
1154114180 18:11596769-11596791 AAATAGAAAGAGGCTGGGCACGG + Intergenic
1155002072 18:21697361-21697383 AAGGATAAATAGGCTGGGCACGG - Intronic
1155189023 18:23413157-23413179 ATGGAGCTTGAGGCTGGGCACGG - Intronic
1155374296 18:25139078-25139100 ATGCAAAAAGACGCTGGGCACGG + Intronic
1155859630 18:30880877-30880899 ATGCAGAATGATGCTGATCAAGG - Intergenic
1156389719 18:36639072-36639094 TTGAAGAAAGACCCTGAGCAGGG + Intronic
1156453323 18:37279022-37279044 ATGGAGGAGGAGGGTGGGCACGG - Intronic
1156503233 18:37572946-37572968 AGGGAGGGAGAGGCTGAGGATGG + Intergenic
1156675739 18:39525185-39525207 ATGGAGAAAGAGGCTTCTCAAGG - Intergenic
1156890659 18:42186406-42186428 ATGGTGAGAGAGGCTGTGTAGGG + Intergenic
1157165977 18:45358866-45358888 GTGGGGAAAGAGGCTGGGCATGG - Intronic
1157287299 18:46385709-46385731 TTGGAGCAAGAGGCTGGGGAGGG - Intronic
1157398536 18:47365680-47365702 ATAGAGACTAAGGCTGAGCATGG - Intergenic
1157418791 18:47527533-47527555 ATGGAGGAGGAGACTGAGCTGGG + Intergenic
1157551283 18:48583270-48583292 AAGGACAAGGAGGCAGAGCAGGG + Intronic
1157732249 18:50014256-50014278 ATGGAGAAAATGGATGAGAAAGG + Intronic
1157811881 18:50703177-50703199 ATGGAGAAGGGGAGTGAGCATGG - Intronic
1158416944 18:57256971-57256993 AGGGAGCAGGAGGCTGGGCAGGG + Intergenic
1158584257 18:58717069-58717091 ATTGAGGAAAAGGCTGGGCATGG + Intronic
1158891209 18:61873622-61873644 ATGGAGACTGAGGCTGGGCGTGG - Intronic
1158979963 18:62750367-62750389 ATGGAGAGAGAGGGAGAGCAGGG - Intronic
1159026547 18:63187673-63187695 ATGGAGACAGAGGCTTGGAATGG + Intronic
1160162476 18:76484168-76484190 ATGGAGAAAAAGGCTAAGCTGGG + Intronic
1160518714 18:79492287-79492309 ATGAAAAATGAGGCTGGGCACGG + Intronic
1161074791 19:2280362-2280384 AAAGAGAGAGAGGCTGGGCACGG - Intronic
1161299855 19:3537387-3537409 ATGGAGGGGGAGGCTGACCAAGG + Intronic
1161312215 19:3601042-3601064 ATGGAGGAAAAGGCCGGGCACGG - Intronic
1161379025 19:3954838-3954860 ATGGAGGTAGAGGCCGGGCATGG - Intergenic
1161511479 19:4674715-4674737 ATGGAGCAAGTGGATAAGCAGGG + Intergenic
1161727235 19:5936627-5936649 ATGAGAAAAGAGGCTGAGCCGGG + Intronic
1161904557 19:7146531-7146553 CTTGACAAAGAGGTTGAGCATGG - Intronic
1162114841 19:8422681-8422703 ATTTAAAAAGAGGCTGGGCACGG - Intronic
1162403902 19:10462076-10462098 TGGGAGAAAGAGGCTGAGGAAGG - Intronic
1162436901 19:10666233-10666255 AAGAAAAAAGAGGCTGGGCATGG - Intronic
1162444816 19:10716343-10716365 ATGGAGAAAGAGGAGGAGGGTGG - Intergenic
1162531590 19:11239352-11239374 ATGGAGAAACAGGCTCAGCATGG + Intronic
1162537598 19:11272642-11272664 AGGGGGAAAGGGGCTGGGCAAGG - Intergenic
1162557113 19:11394154-11394176 ATGTAGAAAGAGGTGGGGCATGG - Intronic
1162947023 19:14050209-14050231 ATGAAGCAAGGGGCTGGGCAAGG + Intronic
1163043705 19:14623385-14623407 ATCTAAAAAGAGGCTGGGCATGG - Intronic
1163345482 19:16739200-16739222 AAGGAGAGAGAGGCTGACCATGG + Intronic
1163501445 19:17678822-17678844 ATGCTGACAGAGGCTGAGAAAGG + Intronic
1163597497 19:18228701-18228723 ATGGAGAAAGAGTCACAGCAAGG + Intronic
1163785187 19:19271295-19271317 AGGAAGAAACAGCCTGAGCAAGG - Intronic
1163799629 19:19356703-19356725 GGGGACCAAGAGGCTGAGCAGGG - Exonic
1163873641 19:19846994-19847016 ATAGAAGAAGAGGCTGGGCAGGG + Intergenic
1163953653 19:20613959-20613981 AAGGAGAAAGAGTGTGAGAAGGG + Intronic
1164601013 19:29563169-29563191 ATGGAGGAAGAGGACAAGCAGGG + Intronic
1164735664 19:30539328-30539350 ATAGAACAAAAGGCTGAGCAAGG - Intronic
1164953878 19:32363983-32364005 ATGGGAAAAGAGGCTTAGTATGG - Intronic
1165171335 19:33894112-33894134 AAGAAAAAAGAGGCTGGGCACGG - Intergenic
1165324722 19:35107832-35107854 AAGGAGAAAGTGGCTGTGCTAGG + Intergenic
1165858801 19:38895780-38895802 AGAGAGAGAAAGGCTGAGCACGG + Intronic
1166142890 19:40814685-40814707 GGGAAGAAAGAGGCTGGGCATGG - Intronic
1166184668 19:41132127-41132149 GGGAAGAAAGAGGCTGGGCACGG + Intergenic
1166284748 19:41817921-41817943 ATGTGAAAAGAGGCTGGGCATGG - Intergenic
1166325399 19:42047176-42047198 CTGGGGAAGGGGGCTGAGCATGG - Intronic
1166443069 19:42833167-42833189 ATGAGGAAAGAGGCTGAGGGAGG + Intronic
1166468899 19:43060384-43060406 ATGAGGAAAGAGGCTGAGGGAGG + Intronic
1166597303 19:44061175-44061197 ATGGAGAATGAGGGAGAGTATGG - Intronic
1166757189 19:45200470-45200492 AAGCAGAAAGGGGCTGGGCACGG - Intronic
1166763675 19:45239857-45239879 GTGGAGAAACAGGCTGAGAGGGG + Intronic
1167139515 19:47639984-47640006 ACTGTGAAAGAGGCTGAGCCTGG - Intronic
1167199784 19:48056533-48056555 AGCAAGAAAGAGGCTGGGCATGG + Intronic
1167294187 19:48639788-48639810 GTTGACAAAGAGGCTGAGAATGG + Exonic
1167682588 19:50933432-50933454 ATGAAGAAAGGGGCCGGGCATGG - Intergenic
1167854284 19:52225675-52225697 AGGGAGAGAGAGGGTGAGCCAGG - Intronic
1168091085 19:54084829-54084851 ATAGAGAAGGCGGCTGGGCATGG + Intergenic
1168114308 19:54212677-54212699 AAGAAAAAAGAGGCCGAGCATGG - Intronic
1168292643 19:55364053-55364075 ATGGAGAAACAGGTTCAGTAAGG - Intergenic
1168307670 19:55444196-55444218 AGGGAGATACAGGCTGAGAAAGG + Intergenic
1168368970 19:55815236-55815258 ATTTAGCAAGAGGCTGGGCACGG + Intronic
1168573767 19:57491373-57491395 ATTAAGGAAGAGGGTGAGCAGGG + Intronic
1168575375 19:57504562-57504584 ATTAAGGAAGAGGGTGAGCAGGG + Intronic
1168598165 19:57695825-57695847 AGGGAAAAAGAGGCTGGGCTCGG - Intronic
925033909 2:671959-671981 GTGGAGGGAAAGGCTGAGCAGGG + Intronic
925148664 2:1599993-1600015 ATGGAAAAAGACGTTGAACAGGG - Intergenic
925356496 2:3245501-3245523 ATGGGGAATGAGGCTGGGCATGG - Intronic
925702234 2:6650402-6650424 ATGAAAAAAGAGGCTGAGAAGGG + Intergenic
925864275 2:8212527-8212549 ATAGAGAAAGAGGGAGAGGAAGG - Intergenic
926052668 2:9754714-9754736 CTGGAGAGAGAGGGTGGGCAGGG + Intergenic
926887024 2:17607170-17607192 AAGGAGAATGGGGCTGAGCCAGG + Intronic
926909881 2:17842708-17842730 AAGAAGAAAGGGGCTGAGCGTGG + Intergenic
927475915 2:23414119-23414141 CAGAAGAAAGAGGCTGAGGAGGG + Intronic
927602853 2:24459533-24459555 AAGGACAAAGAGTCTGAACAGGG + Intergenic
928357202 2:30629267-30629289 ATACAAAATGAGGCTGAGCATGG + Intronic
928644037 2:33332978-33333000 TGGGAGAGAGAGGCTCAGCAAGG + Intronic
929787845 2:45004899-45004921 GTGGAGAAAGAGGCTGGCAAGGG + Intergenic
930149651 2:48045465-48045487 CAGGAGCAAGAGGCTGAGAAGGG + Intergenic
930601247 2:53445508-53445530 AATGAGAAAGATGATGAGCAGGG + Intergenic
930846905 2:55916398-55916420 ATGAAGCAAGGGGCTGGGCACGG - Intronic
930956610 2:57210502-57210524 ATGGGGAAAGAGCCTTAGAATGG - Intergenic
931229511 2:60362468-60362490 AAGTAGATAGCGGCTGAGCACGG + Intergenic
931279846 2:60780564-60780586 AAGGAAAAAAAGGCCGAGCATGG - Intronic
931940961 2:67252025-67252047 AGGGAGAAAGGGGCAGAGCTGGG + Intergenic
932196503 2:69788545-69788567 AGAAAGAAAGAGGCTGGGCACGG + Intronic
932528702 2:72502255-72502277 ATGGGTAAAGAGGCTGGGCGTGG + Intronic
932590350 2:73062394-73062416 AGGAGGAAAGAGGATGAGCAGGG + Intronic
932661848 2:73661537-73661559 ATGGGCAAAGGGGCTGGGCACGG - Intergenic
932673192 2:73755780-73755802 AAAGTCAAAGAGGCTGAGCACGG + Intergenic
933043588 2:77503318-77503340 ATGGAGTATGAGGGTGAGGATGG + Intronic
933097151 2:78199843-78199865 AGGCATAAAGAGGCTGAGAAAGG + Intergenic
933992783 2:87645663-87645685 ATGGAGACAGAGGCAGAGATTGG + Intergenic
934477197 2:94601678-94601700 CTGGAGAAGGACGCTGGGCAGGG + Intronic
934567676 2:95349593-95349615 ATGGACAAGGGGGCTGAGCCCGG + Intronic
934728955 2:96644186-96644208 AAAAAGAAAGAGGCTGGGCATGG + Intergenic
934843402 2:97645904-97645926 GTGCAGAAAGAGGCAGAGCTGGG + Intergenic
935271733 2:101440616-101440638 ATGGAAAAAGAGGCAGAGTCTGG - Intronic
935292887 2:101624931-101624953 AAGGAGAAAGAGCCTGTGCTGGG + Intergenic
936002817 2:108851155-108851177 ATGAAGAGAGAGACAGAGCAAGG + Intronic
936011697 2:108929213-108929235 ATGGAGAATGACGCTGAGTGTGG - Exonic
936301073 2:111305216-111305238 ATGGAGACAGAGGCAGAGATTGG - Intergenic
936742988 2:115537367-115537389 AAGTAGAAATAGGCTTAGCATGG + Intronic
936933738 2:117817707-117817729 ATGGTGAATGATGCTGAGCCTGG + Exonic
937207692 2:120246897-120246919 AGGGAGGGAGGGGCTGAGCAGGG + Intronic
937301422 2:120844980-120845002 AAGGAGAAAGAAGCTGGGCACGG + Intronic
937524328 2:122748529-122748551 AGAGAGAACAAGGCTGAGCAAGG - Intergenic
938028580 2:127972188-127972210 GTGCAGAAATAGGGTGAGCAGGG - Intronic
938785664 2:134626393-134626415 CTGGAAAAGGAGGCTGGGCATGG - Intronic
939010436 2:136840086-136840108 ATCAAAAAAGAGGCTGAGCGTGG + Intronic
939069243 2:137518955-137518977 AAGGGGAAAGGGGCTGGGCACGG + Intronic
939174489 2:138733952-138733974 AAGAAGAATGAGGGTGAGCATGG + Intronic
939378859 2:141407999-141408021 ATCCAGAAAGAGGCTCAGCCTGG + Intronic
939387414 2:141518656-141518678 AGGGAGAGAGAGGCCGGGCATGG + Intronic
939396748 2:141640494-141640516 AGTCAGAAAGAGGCTGGGCACGG + Intronic
940199270 2:151132142-151132164 AGAGAGAGAGAGGCTGGGCATGG + Intergenic
940949384 2:159655151-159655173 GTGAAGAAAGAGGCTGAGGCAGG + Intergenic
941257186 2:163246718-163246740 ATGGATAAAGATGTTGAACAAGG + Intergenic
941520674 2:166537944-166537966 ATGGAGAGAGAGAGAGAGCATGG - Intergenic
941779489 2:169428502-169428524 ATGTAGAAAGATGCTGAAAATGG + Intergenic
941995202 2:171595539-171595561 AAGGAGGAAGAGGCAGAGTATGG + Intergenic
942103127 2:172605663-172605685 ATTTACAGAGAGGCTGAGCACGG - Intronic
942111045 2:172683054-172683076 ACGTATAAAGAGGCTGGGCATGG + Intergenic
942829947 2:180227748-180227770 ATCGAGAAAGAGACTAAGCCTGG - Intergenic
943338502 2:186647641-186647663 ATGTAAAAAGAGACTGAGAAAGG + Intronic
943458183 2:188134692-188134714 AAGGAGAAAGAGACTGAGAGAGG + Intergenic
943656420 2:190513437-190513459 ATGGTGAGTGATGCTGAGCAGGG - Intronic
944175538 2:196824941-196824963 ATGGGTAAAGGGGCTGAGCATGG + Intergenic
944630963 2:201623550-201623572 GTAGCAAAAGAGGCTGAGCAGGG - Exonic
944822451 2:203444141-203444163 AGAGAGAGAGAGGCTGGGCACGG + Exonic
945008280 2:205433240-205433262 ATTGAGATATAGGCTGGGCACGG + Intronic
945130168 2:206562746-206562768 TTGGAGAAAAAGGCTTTGCAAGG + Intronic
945447568 2:209956032-209956054 GAGGAGAAATAGGCTGAGTATGG - Intronic
946000779 2:216480508-216480530 ATTCAGAAAGAGGCTGATGAGGG + Intronic
946028064 2:216684165-216684187 TTGGAGAAAGTGGTTGAGCTTGG - Intronic
946106774 2:217377495-217377517 ATGGAGAAAAAAGCAAAGCAGGG + Intronic
946153418 2:217791293-217791315 CTGGAGAAAGAGAATGAGAAAGG - Intergenic
946965175 2:225029460-225029482 ATAGATAAAGAGGCCGGGCATGG - Intronic
947400624 2:229728093-229728115 ATAAATAAAGAGGCTGGGCACGG + Intergenic
947507095 2:230716141-230716163 ATGAAGTAAGATGCTGAGTAAGG + Intronic
947579667 2:231307208-231307230 GTGGAGCAAGAGGCTGAGAGAGG + Intronic
947768409 2:232652035-232652057 ATGGAGAAACAGGCCCACCAAGG - Intronic
947810369 2:233000385-233000407 AAAGAGGAAGAGGCTGGGCACGG - Intronic
947841413 2:233210151-233210173 ATGGAGGAAGAGCATGAGCTGGG - Intronic
948049104 2:234966086-234966108 GAGGAGAAAGAGGCTGGGCACGG + Intronic
948369861 2:237481955-237481977 AAAGAGAAAGAGGCTGAGTTGGG + Intergenic
948740754 2:240044282-240044304 CAGGAGAAAGAGGCTGGGTATGG - Intergenic
949081272 2:242101818-242101840 ATAAAGAAACAGGCTGGGCACGG - Intergenic
1168731134 20:82027-82049 AAGGAGAAATAGGCTGGGCATGG + Intergenic
1168749676 20:273583-273605 ATGCAGAATCAGGCTGGGCATGG + Intronic
1169185956 20:3617526-3617548 AATGAAAAAGAAGCTGAGCATGG + Intronic
1169294485 20:4381980-4382002 ATGGGAAAACAGGCTGAGAATGG - Intergenic
1169364639 20:4981989-4982011 AAAAAGAAAGAGGCTGGGCACGG - Intronic
1169638326 20:7720150-7720172 ATGGAAAAAGAAGGTGGGCAGGG + Intergenic
1170343939 20:15362282-15362304 AGGAAGAAATAGGCTGGGCACGG - Intronic
1170524839 20:17227168-17227190 ATAGAGAAAGAGACTGAACAGGG - Exonic
1170586680 20:17740062-17740084 GAGGAGACAGAGGCTCAGCAAGG - Intergenic
1170851590 20:20009640-20009662 ATTGAAAAAGAGGCCGGGCATGG - Intergenic
1170908106 20:20535131-20535153 AGGGAGTAAGAGGCTGAGCTGGG + Intronic
1171400637 20:24871225-24871247 ATGCAGGGACAGGCTGAGCATGG + Intergenic
1172190580 20:33059771-33059793 AGGGAGGCAGAGGCTGAGAAGGG + Intronic
1172527864 20:35611379-35611401 ATGGAGAAATAGGCAGAACAGGG - Intergenic
1172543137 20:35737570-35737592 ATAAAGACAGAGGCTGGGCACGG + Intronic
1172643115 20:36453640-36453662 AAGAAAAAAGAGGCTGGGCACGG + Intronic
1172665887 20:36599610-36599632 CAGCAGAAAAAGGCTGAGCACGG + Intronic
1172769479 20:37371282-37371304 AAGAAGAAATAGGCTGGGCACGG - Intronic
1172842179 20:37908520-37908542 ATGGAGAGATTGGCTGGGCACGG + Intronic
1172884357 20:38221352-38221374 AGGGTGGAAGAGGCTGAGAAAGG + Intronic
1173145677 20:40522139-40522161 ATGGGGTAAGTGGATGAGCAGGG + Intergenic
1173592044 20:44232237-44232259 ATAGGGAAAGCGGCTGGGCACGG + Intergenic
1173608536 20:44349777-44349799 AGGGAGAAAAAGGCTGGGCGCGG + Intronic
1173613861 20:44390215-44390237 ATGGAGAAACACGCTCAGAAAGG + Intronic
1173811873 20:45960758-45960780 ATGGAGAAAGAAGTGGAGGAGGG + Intronic
1173938867 20:46893509-46893531 AGGCAGAAAGTGGCTGAGCCAGG - Intergenic
1173997150 20:47347020-47347042 AGGGAGGAAGAGGCTGGACAGGG - Intronic
1174200638 20:48804341-48804363 AGGGAGACAGAGGGGGAGCATGG + Intronic
1174214713 20:48907455-48907477 AAAAAGAAAGAGGCTGAGCATGG - Intergenic
1174253387 20:49236031-49236053 ATGGGGATAGAGGCTGGGCACGG - Intronic
1174462686 20:50694010-50694032 AGAAAGAAACAGGCTGAGCATGG + Intergenic
1174607190 20:51769168-51769190 ATAGAGAATGAGGGTGAGGATGG - Intergenic
1174753892 20:53139381-53139403 TTGAAGAAAGAGACTGGGCAAGG + Intronic
1174897432 20:54465699-54465721 ATGGAGAAAGAGACTAAAAAGGG + Intergenic
1174947392 20:55003259-55003281 AAGGAGATAGACGCTGGGCAGGG - Intergenic
1174993036 20:55534534-55534556 ATGGTGGAAGAGGCAGTGCAAGG + Intergenic
1175196222 20:57245015-57245037 AGGGAGACAGGGGCTGGGCATGG - Intronic
1175765289 20:61588193-61588215 ATTGGGAAAGAGGCTGAACTGGG + Intronic
1175987404 20:62770848-62770870 ATGGGGAAACAGGCTGGGAAAGG + Intergenic
1176134651 20:63516884-63516906 ATGGAAAACGAGGCCGGGCACGG - Intergenic
1177366643 21:20148300-20148322 AAGGGGAAAGGGGCTGAGCATGG - Intergenic
1178424558 21:32469014-32469036 GAGGAGAAAGAGCCTGTGCATGG - Intronic
1178463761 21:32827154-32827176 ATTGGGGAAGAGGCTGGGCATGG + Intergenic
1178746112 21:35251763-35251785 TTGGAGGAAGAGGATGTGCAAGG + Intronic
1179045397 21:37839952-37839974 ATGCAAAAATAAGCTGAGCATGG - Intronic
1179147698 21:38782942-38782964 ATGAAAAAGGAGGCTGAGCACGG - Intergenic
1179388305 21:40963141-40963163 AAGGAGGAAGAGACTGAGGAAGG + Intergenic
1179557390 21:42188527-42188549 AGGGAGAAGGGGGCTGGGCAAGG + Intergenic
1180100821 21:45584247-45584269 GTGGAGAAGGAGACAGAGCAGGG - Intergenic
1180720172 22:17902106-17902128 GTGGAGACAGAGGCTGTGCACGG + Intronic
1180738920 22:18039619-18039641 AGGGAGCAAGAGGCTGGGCATGG + Intergenic
1180868674 22:19134046-19134068 CTGGAGAAAGGGGCTGTGCTGGG - Exonic
1181387257 22:22555526-22555548 AAAGAAAAAGAGGCTGGGCATGG - Intronic
1181639497 22:24189244-24189266 ATGGAGAGAGAGCCTGGGGAGGG - Intergenic
1181645765 22:24231269-24231291 ATGGAGGAGGAGGCTGAGCTGGG + Intronic
1181751368 22:24991311-24991333 AGGAAGAAAGGGGCTGGGCATGG - Intronic
1181952429 22:26564115-26564137 ATGGAGACTGAGGCTGAACGAGG + Intronic
1181962770 22:26634885-26634907 ATTCAGGAAGAGGCTGGGCAAGG - Intergenic
1181982845 22:26778315-26778337 ATGAAGATGGAGGCTGGGCATGG - Intergenic
1181995927 22:26882471-26882493 ATGGAGAAAGGGAGTGAGAAGGG - Intergenic
1182069937 22:27456360-27456382 ATGGGGAAAGGGGCTGAGTGCGG + Intergenic
1182425929 22:30272420-30272442 AAAAAAAAAGAGGCTGAGCACGG + Intergenic
1182487303 22:30647105-30647127 ATGGAGAACAGGGCTGGGCATGG + Exonic
1183029861 22:35095479-35095501 ATGGAGAAGGAGGTTGGGAATGG + Intergenic
1183068103 22:35377586-35377608 ATGGAGGATGAGGCTGGGCACGG - Intergenic
1183121367 22:35732540-35732562 AGGCAGAAAGAGGCTGGGCGCGG + Intergenic
1183207661 22:36430848-36430870 TTGAAGAAACTGGCTGAGCACGG - Intergenic
1183274723 22:36886650-36886672 GTGGAGAAAGAGGTGGAGAAAGG - Intergenic
1183847101 22:40551124-40551146 ATGTATAAAGAGGCTGGGCACGG - Intronic
1183902522 22:41017269-41017291 ATGCAGAAGCAGGCTGGGCACGG - Intergenic
1183990126 22:41592285-41592307 ATAGGAAAAGAGGCTGAGCGCGG + Intergenic
1184092356 22:42299337-42299359 ATGGAGAGAGTGCCAGAGCAGGG - Intronic
1184186962 22:42871430-42871452 ATGGAGGACGAGGATGAGCAGGG - Exonic
1184244836 22:43230705-43230727 AGGGACGAAGAGGCTGAGCCTGG + Intronic
1184449734 22:44575843-44575865 AGGGAGAAAGAGGAGGAGGAGGG + Intergenic
1184458171 22:44623081-44623103 AATGAGAAAGAGGCCGGGCACGG + Intergenic
1184485981 22:44779856-44779878 ATGAAGAAAAAGGCCGAGCGTGG - Intronic
1184627811 22:45751219-45751241 AAGAACAAAGAGGCTGGGCATGG - Intronic
1184641003 22:45870056-45870078 CTGGAGAAAGAGACTGACAAAGG - Intergenic
1184807925 22:46808065-46808087 ATGCAGTAAGGGGCTGGGCACGG + Intronic
1184933797 22:47703519-47703541 ATGGAGACTCAGGCTGTGCATGG - Intergenic
949246273 3:1928363-1928385 AGGGAGAAAGAGGATGAATAGGG + Intergenic
949438799 3:4057950-4057972 GTTGAGAAAGTGGCAGAGCAGGG + Intronic
949820065 3:8106535-8106557 ATGCAGAAATTAGCTGAGCATGG + Intergenic
949821302 3:8118585-8118607 ACAGAGATAGAGGCTGAGCAGGG - Intergenic
949855502 3:8457579-8457601 ATGGATAAGGAGGCTGAGGCGGG + Intergenic
950158808 3:10743641-10743663 AGGGAGACTGAGGCTGGGCAGGG + Intergenic
950226408 3:11238493-11238515 ATGAAGAAAGAGGCTGCTCTGGG - Intronic
950403921 3:12792757-12792779 AAAGAAAAAGAGGCTGGGCATGG - Intergenic
950458591 3:13107481-13107503 ATGGAGAAACAGGCTCAGAGCGG + Intergenic
950488277 3:13285582-13285604 ATGGAGACAGAGAATGAGCAAGG + Intergenic
950790254 3:15465894-15465916 CTAGAGAAAGAGGCTGGGCATGG - Intronic
950906049 3:16539134-16539156 AGGGGGAAGGATGCTGAGCATGG + Intergenic
951518496 3:23588709-23588731 GTGGAGAAAGGGGTGGAGCAGGG - Intronic
951653772 3:24981854-24981876 AGGGAGATAGAGGCAGAGGATGG - Intergenic
952066154 3:29573405-29573427 ATGAAAAAGGAAGCTGAGCATGG - Intronic
952309324 3:32173294-32173316 AAGAAGGATGAGGCTGAGCATGG - Intergenic
953678381 3:45021073-45021095 ATGGAGAACCACGCTGAGGAGGG - Intronic
954220572 3:49151119-49151141 TTGGAGGAAGAGTCTGAGCAGGG - Intergenic
954288858 3:49638402-49638424 ATGGAGGAAGAGACTGAGGTTGG + Intronic
954792351 3:53142776-53142798 ATGGGGAAACAGGCTCTGCAGGG - Intergenic
954804146 3:53205855-53205877 TAGGAGAAATAGGCTGGGCATGG + Intergenic
955170401 3:56558148-56558170 AGGGAGAGAGAGGCTGGGAAAGG - Intronic
955209250 3:56925661-56925683 ATGAGGAAAGAGGCTCAGAAGGG + Intronic
955349762 3:58184704-58184726 AAGGGGAGAGAGACTGAGCATGG + Intergenic
956012808 3:64849491-64849513 AAAAAAAAAGAGGCTGAGCATGG - Intergenic
956647436 3:71470230-71470252 ATGAAGAAACAGGCTCAGGAAGG - Intronic
956665412 3:71637534-71637556 AAGGAGAAAGAGGGGGAGGAGGG + Intergenic
956780010 3:72596283-72596305 TTGGAGGAATAGACTGAGCAGGG + Intergenic
957162900 3:76633509-76633531 AAGGAGAAAGAAGATGAGAAAGG + Intronic
957252498 3:77791639-77791661 ATAGGGAAAGAAGCTAAGCATGG - Intergenic
957261392 3:77906519-77906541 ATGGAGAAGGAGGCTGAAGAAGG + Intergenic
957740288 3:84257955-84257977 AGGGAGAAAGAGGCAGAGAGGGG - Intergenic
957971171 3:87384519-87384541 AGGGATAAATAGGCAGAGCACGG - Intergenic
958833770 3:99119856-99119878 ATCTAGAAAGAGGCCGAGCCAGG - Intergenic
959058061 3:101587980-101588002 ATGGAGAAATTGACTGGGCATGG + Intronic
959659108 3:108845442-108845464 ATGGAGAAAAATCATGAGCAGGG + Intronic
960105590 3:113792624-113792646 ATGTACAAAGAGGCCAAGCATGG - Intronic
960419687 3:117428427-117428449 ATGGGGAAGTAGGCTGGGCATGG - Intergenic
960579556 3:119264582-119264604 AAGAAGAAATAGGCTGAGCACGG + Intergenic
960779067 3:121297461-121297483 ATAGGAAAAGAGGCTGGGCATGG + Intronic
961214927 3:125152008-125152030 ATTGAGAAAGTGGCAGAGCCAGG + Intronic
961270265 3:125682766-125682788 ATGGAGAATGTGGCCGAGCCTGG + Intergenic
961670462 3:128524566-128524588 AGGGAGAAGTGGGCTGAGCACGG + Intergenic
961767650 3:129224289-129224311 ATGCAAAAATTGGCTGAGCATGG + Intergenic
962859112 3:139381163-139381185 ATAAATAAAGAGGCTCAGCATGG + Intronic
963739588 3:149063348-149063370 AAAGAGATAGAGGCTGGGCACGG - Intronic
964392630 3:156213502-156213524 AAAGGGAAAAAGGCTGAGCAAGG - Intronic
964665130 3:159163653-159163675 ATGAAAAATGAGGCTGGGCATGG - Intronic
964936759 3:162098617-162098639 ATGGAGACCGAGTCTGAGGAGGG + Intergenic
964966940 3:162506094-162506116 ATGGAAAAATGGGCTGGGCATGG + Intergenic
965175058 3:165321028-165321050 AATGAGGAAGAGGGTGAGCAGGG - Intergenic
965340088 3:167479938-167479960 ATGGAAAAAAAGGCCGGGCACGG + Intronic
965430660 3:168583815-168583837 AGGGAGAAAGAGGAGAAGCAAGG + Intergenic
965464816 3:169015330-169015352 ATTCAGCAATAGGCTGAGCATGG - Intergenic
965577055 3:170228307-170228329 ATACAGAAAGAGGCTGGGTATGG + Intronic
965709779 3:171545608-171545630 AGAGAGAAAGAGACAGAGCATGG - Intergenic
965931524 3:174049403-174049425 AAGGAGAAAAGGGTTGAGCAGGG + Intronic
966826676 3:183970725-183970747 AAGGGGACAGAGGCTGGGCATGG - Intronic
966871274 3:184291812-184291834 ATAGAGTAAGTGGCAGAGCAAGG + Intronic
968077094 3:195821969-195821991 ATGGAGACTGAGGCTCAGCTAGG - Intergenic
968236108 3:197030611-197030633 AAGGAGAAACAGGCGGAGAAGGG + Intergenic
968312327 3:197694377-197694399 ATGTACCAGGAGGCTGAGCACGG - Exonic
968513647 4:1006117-1006139 AAGAAAAAAGAGGCTGGGCACGG - Intergenic
968764206 4:2459614-2459636 ATGGAGCAGGAGGTTGAGGAGGG + Intronic
968841310 4:3008319-3008341 AAACAGTAAGAGGCTGAGCAGGG - Intronic
969212903 4:5701422-5701444 AGGGAGAAAGGGGCTCACCATGG - Intronic
969264162 4:6054346-6054368 AAGGAGACAGAGGCTGGGCCAGG + Intronic
969752396 4:9121425-9121447 ATAGAAAAAGTTGCTGAGCATGG - Intergenic
969966699 4:11003864-11003886 ATGGAGAAACAGGCTCAGGGAGG + Intergenic
970138730 4:12956447-12956469 ATGAAGAAACAGGCTCAGCAAGG - Intergenic
970192672 4:13530472-13530494 AGGGAAGAAGAGGCTGAGCAGGG + Intergenic
970249602 4:14100316-14100338 ATGGAGACAAAGAGTGAGCAAGG + Intergenic
970304523 4:14717988-14718010 ATGCAGAAACAGGCTGGGCACGG - Intergenic
970422137 4:15915191-15915213 ATGGGGACAGAGGCTGCCCAAGG + Intergenic
970838007 4:20434195-20434217 ATGGGGAAGGAGGCTGGGCGTGG + Intronic
971029423 4:22620847-22620869 ATGGGGAAAAAAGCAGAGCAGGG + Intergenic
971190299 4:24421686-24421708 ATGGAGGCAGTGGCTGAGGAAGG - Intergenic
971570646 4:28206347-28206369 AAGTAGAAAGAGGCTAAGCATGG - Intergenic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
972210552 4:36831478-36831500 ATGGCAAAAGAGGCTGGGCACGG + Intergenic
972343537 4:38173792-38173814 TTGAAGACAGTGGCTGAGCATGG + Intergenic
972591112 4:40488029-40488051 AGAGAGAGAGAGGCTGGGCACGG + Intronic
972919729 4:43923590-43923612 ATGGACAAAGAGGCTGAATGAGG + Intergenic
973282660 4:48376161-48376183 ATGAAGGAAGGGGCTGGGCACGG + Intronic
973619059 4:52709688-52709710 ATGGAGGAGGAGACTGAGAAAGG + Intergenic
973635387 4:52857474-52857496 ATGGAAAATGATTCTGAGCAAGG + Intergenic
974034619 4:56807033-56807055 AAGAAGAAACAGGCTGGGCACGG + Intergenic
975043827 4:69777538-69777560 ATGGAGAAAGAGGAAGACGATGG + Intronic
975091664 4:70411160-70411182 ATTGAGAATGAGGCAGAGAAAGG + Intergenic
975541323 4:75514704-75514726 CTGGAGAAAGGGGCGGAGCTCGG + Intronic
975575358 4:75857237-75857259 GTGGATAAAGAAGCTGAGCATGG + Intergenic
975666297 4:76738598-76738620 ACACAGAAGGAGGCTGAGCAAGG + Intronic
976180323 4:82392787-82392809 ATTTTGAAAGAGGCTGAGCCAGG + Intergenic
976266884 4:83193352-83193374 ATGGAGAGATAGGCAGGGCAAGG - Intergenic
976515992 4:85967059-85967081 ATGGGGATAGAGAATGAGCAAGG + Intronic
977133092 4:93267443-93267465 ATGGAGAAAGAGGTGCAGCCTGG + Intronic
977238503 4:94538543-94538565 ATGGAGAAAGCAGCAGAGCAAGG - Intronic
977270816 4:94915951-94915973 AAGTAGGAAGAGGCTGAGAAAGG - Intronic
977980721 4:103318264-103318286 AAGGAGAAGGAGGAGGAGCAGGG - Intergenic
978202074 4:106033788-106033810 ATGGAAACTGAGGCTCAGCAAGG + Intergenic
978222429 4:106292971-106292993 ATTTTGAAAGAGGCTGAGCCAGG + Intronic
978261112 4:106760563-106760585 ATGTAAAAAGAGGCCGGGCACGG + Intergenic
978315995 4:107437831-107437853 ATTTTGAAAGAGGCTGAGCCAGG - Intergenic
978571707 4:110145156-110145178 AGTGAGAAAGAAGCTGTGCAAGG + Intronic
979129963 4:117031335-117031357 ATGAGGAAAGAGGATGAACAAGG - Intergenic
979375323 4:119939706-119939728 ATGAAAACAGAGGCTGAGAAAGG + Intergenic
979416297 4:120443542-120443564 AGCTAGGAAGAGGCTGAGCAGGG - Intergenic
979865751 4:125751153-125751175 ATGGAGAAAGTGGCAGAGAATGG - Intergenic
979903358 4:126252225-126252247 ATAGAGAAGGAGGCTTAGGATGG + Intergenic
980405791 4:132353017-132353039 CTGGGGAAAGAGGCTGAGTGGGG + Intergenic
980895564 4:138856547-138856569 AGAGAAAAAAAGGCTGAGCATGG + Intergenic
982025669 4:151251913-151251935 ATTGAGAAAGAGGATGGGAATGG - Intronic
982159026 4:152548665-152548687 ATGGTGGCAGAGCCTGAGCAGGG - Intergenic
982223193 4:153141991-153142013 AGAAAGAAAGAGGCTGGGCATGG - Intergenic
982263306 4:153515100-153515122 AGGGTGAAGTAGGCTGAGCACGG - Intronic
982291532 4:153787894-153787916 GTGCAGAATGAGGCTGAGCGAGG + Intronic
982413406 4:155104625-155104647 AAGGAGATTGAGGCTGGGCATGG - Intergenic
982487816 4:155989137-155989159 CTGGAAAAATAGGCTGGGCATGG - Intergenic
983050177 4:163037551-163037573 ATCCAGAAGGAGGCGGAGCATGG + Intergenic
983301737 4:165934303-165934325 ATGGAGAATGAGGCCAAGCATGG - Intronic
983589271 4:169389764-169389786 ATGAAGAAATGGGCTGGGCATGG - Intergenic
984038855 4:174704002-174704024 AGGATGAAAGAGGCTGGGCACGG + Intronic
984613409 4:181867370-181867392 ATGGAGACTGAGGATGAGTATGG - Intergenic
984632565 4:182076181-182076203 AAGGAGAAAGAGGCTGGGCATGG - Intergenic
984632613 4:182076490-182076512 AAGGAGAAAGAGGCTGGGAGTGG - Intergenic
984820826 4:183880277-183880299 ATGGATAAAGAAACTCAGCAGGG - Intronic
984950049 4:185001431-185001453 GGGTAGAAAGAGGCTGGGCACGG + Intergenic
985939340 5:3121947-3121969 AGGGAGGAAGGGGCTGAGAAAGG - Intergenic
986226126 5:5814781-5814803 ATAGTCTAAGAGGCTGAGCACGG - Intergenic
986346894 5:6844080-6844102 ATGGAGCAAGAGGTTGAGGAAGG + Intergenic
986707305 5:10462601-10462623 AGTGAGATAGAGGCTGGGCACGG + Intronic
987047921 5:14124834-14124856 ATGGAGAAGGAGGCCGGGCATGG + Intergenic
987060411 5:14237714-14237736 GTAGAGAAAGTGGCTGAGCCTGG - Intronic
987105074 5:14630498-14630520 ATGGGCAAAGAGGCTGGGCATGG - Intergenic
987172023 5:15269125-15269147 ATGAAGAAACAGGCTAAGCAGGG + Intergenic
987201980 5:15586370-15586392 ATTGAGAAAGAGATTGAGAAAGG - Intronic
987275273 5:16355531-16355553 ATGCAGAAATAGGATGTGCAAGG - Intergenic
987286547 5:16463640-16463662 GAGGAGGAAGAGGCTGAGGAAGG - Exonic
988205196 5:28124580-28124602 CTAGAGAAAGAGGCTGAGTGGGG + Intergenic
988567246 5:32329268-32329290 ATTCAGAAAGAGGCCGGGCATGG - Intergenic
988952396 5:36276803-36276825 ATAGAGTAAGATGCTGAGAATGG + Intronic
989077976 5:37585278-37585300 ATGGACAAGGAGGCTGGGCGCGG - Intronic
989150091 5:38290716-38290738 ATGGAGAAAGCAACTGAGCTGGG - Intronic
989285954 5:39700105-39700127 AGAGAGAGAGAGGCTGGGCACGG + Intergenic
989705280 5:44322385-44322407 ATTTATAAAGAGGCTGAGCCAGG + Intronic
989800719 5:45535305-45535327 ATAGAGAAGCAGGCTGGGCATGG + Intronic
990220850 5:53586811-53586833 AGGAAGAAACAGGCTGGGCACGG - Intronic
990252769 5:53933354-53933376 ATGGAGAAAAAGGCCGGGCGCGG + Intronic
990446324 5:55897138-55897160 ATAAAGAAACAGGCTGGGCATGG - Intronic
990546343 5:56825566-56825588 AAGGATGAAGAGGCTGAGCAGGG - Intronic
990921705 5:60975097-60975119 ATAGAAAAAAAGGCTGGGCATGG - Intronic
991341457 5:65615190-65615212 ATAGAGAAATAGGCTGGGCACGG - Intronic
991363683 5:65846370-65846392 ATGGAACAAAAGGCTGAGTAGGG - Intronic
991504045 5:67305817-67305839 AGGGAGAGCGAGGCTGAGCCAGG + Intergenic
991902795 5:71477135-71477157 AAGGAAAAAGAGGCTGGGCTCGG - Intronic
992154016 5:73936856-73936878 ATGAACAAAGTGGCTGGGCATGG - Intronic
992272254 5:75077222-75077244 ATGGAAAAATTGGCTGGGCATGG - Intronic
992381856 5:76245322-76245344 ATGGAGAAACAGGCTGTGGAAGG + Intronic
992510241 5:77425633-77425655 ATGAAGAAATAGGCTCAGCAAGG - Intronic
992920843 5:81518234-81518256 GAGTAGGAAGAGGCTGAGCAGGG + Intronic
993098516 5:83508097-83508119 AAGGGGAATGAGGCAGAGCAGGG - Intronic
993189349 5:84661525-84661547 ATGTAGAAACAGGCTCAGAAAGG + Intergenic
993330584 5:86595074-86595096 ATGGAAAGAGAGGCTAGGCATGG + Intergenic
993407439 5:87529113-87529135 ATGGAAAAAGAGCATGAGAATGG + Intergenic
993710529 5:91220303-91220325 ATGGAGAAAGAGAATTAGAAAGG + Intergenic
993837754 5:92835602-92835624 ATGGAGAAGGAGGAAAAGCAGGG - Intergenic
994301436 5:98152785-98152807 ATGGACAAAGAAGCTAAGAAAGG + Intergenic
995420146 5:111955795-111955817 ACGGTGTAAGAGGCAGAGCATGG + Intronic
995543872 5:113210518-113210540 ATTGAGAAAGGGACTGAGAATGG + Intronic
995558106 5:113351505-113351527 ATGGAGATAGAGGATAAGGATGG + Intronic
995827113 5:116312776-116312798 AAGCAGAAAGAGGCCAAGCACGG - Intronic
996291948 5:121861663-121861685 AAGGAGAAAGAGGGTAAGGATGG + Intergenic
996325205 5:122265282-122265304 AATGATAAAGAGGCAGAGCACGG - Intergenic
996764344 5:127020693-127020715 ATGGAGAAATTAGCTGGGCATGG + Intronic
996802950 5:127423696-127423718 ATTAACAAAGAGTCTGAGCAGGG - Intronic
996963205 5:129276181-129276203 ATAGAAAAGGAGGCTGGGCATGG - Intergenic
997167257 5:131674422-131674444 ATGGAGAATAGGGCTGGGCATGG + Intronic
997421635 5:133773291-133773313 ATCAAGACAGTGGCTGAGCAGGG - Intergenic
997992961 5:138561397-138561419 ATTGAAAAATAGGCTGGGCATGG - Intronic
998448284 5:142215264-142215286 ATTTAGAAAGAGGCTGGGCGCGG - Intergenic
998450322 5:142229239-142229261 ATGTGGAAAGAGGCTGGTCATGG + Intergenic
998733278 5:145106033-145106055 ATGGACAAAGAGGTGGAGGAAGG - Intergenic
999375410 5:151083163-151083185 AGGTAGTAAGTGGCTGAGCAGGG - Intronic
999477715 5:151916522-151916544 ATGGAGAAAAAGGAAGATCATGG + Intronic
999493607 5:152075182-152075204 ATGAAGACAGAGGCAGAGCCTGG - Intergenic
999507892 5:152217360-152217382 TGGGAGAAAGAGGGTGAGCCAGG + Intergenic
999795294 5:154983262-154983284 ATTGACAAATAGGCTGGGCATGG + Intergenic
1000247789 5:159463254-159463276 ATGCAGGAAGGGACTGAGCAGGG - Intergenic
1000258801 5:159566227-159566249 ATTAAGAATGAGGCTGGGCATGG + Intergenic
1000275283 5:159728885-159728907 ATGGAGAGAGACTCTGAGCCAGG - Intergenic
1000315551 5:160087084-160087106 ATGGAGACACTGGCCGAGCACGG + Intronic
1000553921 5:162700419-162700441 AAGAAGAAAGAGGCCGGGCACGG + Intergenic
1000933383 5:167280096-167280118 ATGTTGACAGAAGCTGAGCAGGG - Intergenic
1001137762 5:169116718-169116740 AGGGAGAAACAGGCTAATCAGGG + Intronic
1001257213 5:170193198-170193220 AAGGACAAAGAGGTTGTGCAGGG + Intergenic
1001283088 5:170402062-170402084 ATGAAGACAGAGGCAGAGCCTGG - Intronic
1001332051 5:170769329-170769351 GAAGAGAAAGAGGCTGAGGAAGG + Intronic
1001778444 5:174346868-174346890 ATAGAGAAGGAGGAAGAGCATGG - Intergenic
1002147654 5:177197917-177197939 ATGGAGACAGAGACAGAGAAGGG + Intronic
1002357300 5:178641224-178641246 ACTGGGAAAGAGGCTGGGCATGG + Intergenic
1002360999 5:178670762-178670784 TCTGAGACAGAGGCTGAGCAAGG - Intergenic
1002398394 5:178976017-178976039 ATGGAGGAGTAGGGTGAGCAGGG - Intergenic
1003033667 6:2624129-2624151 AGGGAGACAGAGGCAGAGCGTGG + Intronic
1003239965 6:4336010-4336032 AGGGAGAAGGAGGGTCAGCATGG + Intergenic
1003547110 6:7068645-7068667 AAAGAAAAAGAGGCTGGGCATGG - Intergenic
1003700544 6:8459945-8459967 AAGTAGAAAGAGGCTGGGCATGG - Intergenic
1004334991 6:14756454-14756476 ATGGGGCAAGAGGCAGGGCAGGG - Intergenic
1004625769 6:17375436-17375458 CAGGAAAAAGAGGCTGAGCGCGG - Intergenic
1005184390 6:23148632-23148654 ATGGATAAATAGGCTAGGCATGG - Intergenic
1005427878 6:25723018-25723040 AAGTAAAAGGAGGCTGAGCATGG + Intergenic
1005450311 6:25965633-25965655 AAAGAAAAAGAGGCTGGGCACGG + Intronic
1005492459 6:26359402-26359424 AAGAAGAAAGAGGCTGGGCGTGG - Intergenic
1005505453 6:26465404-26465426 AAGGTAAAAGAGGCTGAGTATGG + Exonic
1005596435 6:27382827-27382849 ATTGAAAAGCAGGCTGAGCACGG + Intronic
1005853519 6:29841513-29841535 AATGAAAAAGAGGCTGAGGAAGG - Intergenic
1005995947 6:30931557-30931579 ATGGAGGAGGAGGCAGAGCTGGG + Exonic
1006469527 6:34219699-34219721 AAGAAGGAAGAGGCTGGGCACGG + Intergenic
1006504285 6:34478041-34478063 AAGGATAAAGGGGCTGGGCATGG - Intronic
1006504382 6:34478659-34478681 ATGGATAAATAGGCTGAGTGTGG - Intronic
1006527923 6:34624120-34624142 TTGGTGAAGGAGGCTGGGCATGG - Intronic
1006690565 6:35880430-35880452 ATAGAGGAGGAGGCTGGGCACGG + Intronic
1007041055 6:38722810-38722832 ATGGAGAAGGATGCTGAAGATGG + Exonic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1007658762 6:43469306-43469328 ATGGAGACAGAGTCTGTGCTGGG + Intergenic
1007754238 6:44088538-44088560 ATGAAGAAGGAGGCTGGGCACGG - Intergenic
1008082055 6:47204923-47204945 ATGGAGAATGAGGCAGGGCTGGG - Intergenic
1008725201 6:54409069-54409091 ATGAAGAAACAGGCTCAACATGG + Intergenic
1008921738 6:56850098-56850120 ATGGAGACTGAGAGTGAGCAGGG - Intronic
1009527250 6:64763382-64763404 CTGGAGAGAGAGACAGAGCAAGG + Intronic
1010390778 6:75334726-75334748 GTGGAGTAGGGGGCTGAGCAAGG - Intronic
1010449352 6:75985359-75985381 ATGGTTAAAGAGGCAGAGAAAGG + Intronic
1011172620 6:84522724-84522746 AGGGAGAAAGAGCCTGAGAATGG - Intergenic
1011824092 6:91286364-91286386 CAGGAGAGAGAGGCTGAGTATGG + Intergenic
1011899136 6:92270588-92270610 ATGGAAAAATAGGCCGGGCATGG + Intergenic
1012919151 6:105203398-105203420 ATGGAGAAACAGGCTTAGAGTGG - Intergenic
1013085535 6:106853893-106853915 ATCTAGTAAGAGGCAGAGCAGGG + Intergenic
1013183187 6:107735164-107735186 GTTGAAAAAGAGGCTGAGCTCGG - Intronic
1013183269 6:107735882-107735904 ATGGAGATAGATGCTGATGATGG - Intronic
1014539883 6:122662608-122662630 AATCAGAAAGAGGCCGAGCACGG - Intronic
1015331941 6:131989961-131989983 AGGGATTAAGAGGCTGGGCATGG - Intergenic
1015476324 6:133662206-133662228 AAGGAGAAAGAGCTTGTGCAGGG - Intergenic
1015561922 6:134525274-134525296 AAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1015566615 6:134579210-134579232 AGGGGGAAAGAGGGTGAGCTGGG + Intergenic
1016904310 6:149133753-149133775 ATGGAGGATGAGGATGAGGATGG - Intergenic
1017164421 6:151393873-151393895 AAGGAAAAAAAGGCTGAGCGTGG + Intergenic
1017614677 6:156232278-156232300 AAACAGAAAGAGGCTGGGCACGG - Intergenic
1017955758 6:159176507-159176529 TTGGAGAAAGATGCTGAGGAAGG + Intronic
1018131173 6:160733547-160733569 AAGGAAGAAGAGGCTGAGCATGG + Intronic
1018209600 6:161468261-161468283 ATAGGGTAAGAGGCTGGGCATGG - Intronic
1018236868 6:161735101-161735123 TTGTAGAGAGAGGCTGAGGAGGG + Intronic
1018522399 6:164665097-164665119 AGGGAGTCAGAGGCTGAGGAAGG + Intergenic
1018740539 6:166725473-166725495 CTGGAGAAAGAGGCTGGGCTGGG - Intronic
1018792336 6:167158007-167158029 TTGGGGAAAGAGGATGAGCAGGG + Exonic
1018930807 6:168239287-168239309 AAGGAGAGAGGGGCTGGGCAGGG + Intergenic
1019013806 6:168864935-168864957 ATGGAGAAAGAGACAGAGAGAGG + Intergenic
1019362273 7:611029-611051 ATGGAGCAAGAGACAGACCAGGG - Intronic
1019396131 7:819151-819173 ACGGAGAAAGAGGCCAGGCACGG - Intronic
1019579714 7:1755104-1755126 ATGGGAAAAAAGGCTGGGCACGG - Intergenic
1019668791 7:2267094-2267116 ATGGAGAAACAGGCTCAGGGAGG - Intronic
1019784285 7:2964791-2964813 ATTAATAAAGAGGCTGGGCACGG - Intronic
1020032121 7:4940544-4940566 AGGGGGAGAGAGGCTTAGCACGG - Intronic
1020165407 7:5803822-5803844 ATGCATGAAGAGGCAGAGCACGG - Intergenic
1021133364 7:16937645-16937667 ATGGGGCATGATGCTGAGCAAGG + Intergenic
1021410387 7:20323564-20323586 TTGGAGAAGGGGGCTGAGAATGG + Intergenic
1021469440 7:20984870-20984892 AAGGGGAAAGAGGCCGGGCACGG + Intergenic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1021548953 7:21849173-21849195 ATGGAATTAGAGGCTGGGCATGG - Intronic
1021562261 7:21980228-21980250 ATGGAGAAAGAGGTGGTGAATGG + Intergenic
1021902679 7:25302682-25302704 AAGAAGGTAGAGGCTGAGCATGG - Intergenic
1021949811 7:25763682-25763704 GTGGAGAAAGAGGAAGAGCTAGG - Intergenic
1022202628 7:28132250-28132272 AGGGAGAACGAGGATCAGCAAGG + Intronic
1022243872 7:28538342-28538364 ATGGAGTAAGAGGCCAGGCACGG - Intronic
1022525791 7:31036347-31036369 ATGAAGAAACAGGCTCAGAAAGG + Intergenic
1022666939 7:32419932-32419954 ATGGGGTAATAGGCTGGGCATGG + Intergenic
1023006730 7:35878272-35878294 AAGGAGAAGGAGGATGAGAATGG + Intronic
1023725395 7:43137838-43137860 AAGCAGAAAGTGGCTGGGCACGG - Intronic
1023741715 7:43287189-43287211 ATAGGGAAAGAGAGTGAGCATGG + Intronic
1023916439 7:44592939-44592961 ATTAAGAAAGAGGCTGGGCGCGG + Intergenic
1024067431 7:45752368-45752390 AAGGAGAAGGAGGATGAGAATGG - Intergenic
1024185012 7:46940688-46940710 AAGGAGAAAGAGGGTGACAAGGG - Intergenic
1024481165 7:49864786-49864808 ATGGAGACTGCTGCTGAGCAGGG + Intronic
1024644043 7:51356484-51356506 ATGGAGACAAAGCCAGAGCAGGG - Intergenic
1025527041 7:61827516-61827538 ATGGGGAAAGAGGATGTCCAAGG - Intergenic
1025805637 7:64830611-64830633 ATGAAGATACAGGCTGGGCATGG - Intronic
1026105537 7:67417930-67417952 ATGAAGCAAGAGGCAGAGCAGGG - Intergenic
1026262491 7:68767079-68767101 ATGGAGAAAAGGGCCGGGCACGG - Intergenic
1026643539 7:72148612-72148634 AAGAAAAAAGAGGCTGGGCATGG + Intronic
1026646541 7:72175665-72175687 ATGGAGAAGTAGGCAGACCAGGG + Intronic
1026680388 7:72462338-72462360 ATAGAGAAATAAGCTGGGCATGG - Intergenic
1026774022 7:73220153-73220175 AGGCAGGAAGAGGCTGAGAAAGG + Intergenic
1027014879 7:74773539-74773561 AGGCAGGAAGAGGCTGAGAAAGG + Intergenic
1027026739 7:74858210-74858232 ATGGGAAAAGGGGCTGGGCACGG + Intergenic
1027061013 7:75085899-75085921 ATGGGAAAAGGGGCTGGGCACGG - Intergenic
1027073152 7:75172414-75172436 AGGCAGGAAGAGGCTGAGAAAGG - Intergenic
1027214432 7:76174675-76174697 GTGGAAAATGAGGCTGGGCAGGG - Intergenic
1027362825 7:77427245-77427267 ATGAAGAAATAGGCTGGGCGCGG + Intergenic
1027410550 7:77913095-77913117 AAAGAGATAGAGGCTGGGCACGG + Intronic
1027758097 7:82241633-82241655 ATGGAGAAAGAAGCAGAGGGGGG + Intronic
1028003469 7:85531400-85531422 ATGAAGACAGAGGCTGAGACTGG - Intergenic
1028810036 7:95075538-95075560 ATGGAGAGGTAGGCTGGGCATGG + Intronic
1028917194 7:96272176-96272198 ATGAATAAATAGGCTGAGCGTGG - Intronic
1029162201 7:98560396-98560418 ATAGAGAAAGAGGCAGAGAGGGG + Intergenic
1029475884 7:100784416-100784438 AAGGAAAAAGCGGCTGGGCATGG - Intronic
1029568241 7:101353869-101353891 ATGGGGATATGGGCTGAGCACGG + Intergenic
1029653973 7:101912244-101912266 ATGGAGATAGAGGAGGAGGAGGG - Intronic
1029679682 7:102099717-102099739 AGCCAGAAAGAGGCTGGGCACGG - Intronic
1030333931 7:108303331-108303353 ATGAAGAATGAGGAAGAGCAAGG - Intronic
1030359140 7:108577158-108577180 AAGTAGAAAGCGGCTGGGCATGG + Intergenic
1030438080 7:109551604-109551626 ATGGAGAAAGAAGAAAAGCAGGG + Intergenic
1030568130 7:111186719-111186741 AAGTGGAAAGAGGCTGGGCACGG - Intronic
1031074885 7:117202441-117202463 AAGGAGGAAGAGGCTTAGCAGGG - Intronic
1031339596 7:120582597-120582619 ATGGAGAAAGAGGCAGAGGAGGG - Intronic
1031533873 7:122910191-122910213 AGGGAGAAAGGGGCTGGGCGCGG + Intergenic
1031557150 7:123191493-123191515 ATGGAGAAAGAGCTTGGGAAGGG + Intronic
1031732992 7:125320864-125320886 ATAGAGAAAGAGAGTGAGGAGGG - Intergenic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1032512405 7:132482278-132482300 GGCGAGAAAGAGGCTGAGCAAGG - Intronic
1032879956 7:136078180-136078202 ATGCAAAAATTGGCTGAGCATGG + Intergenic
1032960724 7:137030596-137030618 CTGGAGAAAGATACTCAGCATGG - Intergenic
1032963762 7:137071688-137071710 ATGAAGCAAGAGGCTGGGCATGG + Intergenic
1033191577 7:139285524-139285546 AATGAGAAAGAGTCTGAGAATGG - Intronic
1033282346 7:140015273-140015295 AGGGAGCGAGAGGGTGAGCAAGG + Intronic
1033684580 7:143626674-143626696 AGGGAGACAGAGACTGACCATGG - Intronic
1033687756 7:143705893-143705915 AGGGAGACAGAGACTGACCATGG - Intronic
1033700031 7:143830949-143830971 AGGGAGACAGAGACTGACCATGG + Intergenic
1033711210 7:143948303-143948325 ATGGGGAGAGAGGCAGCGCATGG - Intergenic
1033959932 7:146902172-146902194 ATGGAGCATATGGCTGAGCACGG - Intronic
1034077631 7:148247942-148247964 CTGAAGAAAGAGGCTGAGCATGG - Intronic
1034088708 7:148344397-148344419 TTGGAGAAGGACTCTGAGCAGGG - Intronic
1034173601 7:149082871-149082893 AAAGATGAAGAGGCTGAGCATGG - Intronic
1034241541 7:149615091-149615113 ATGTGGATAGAGGGTGAGCACGG + Intergenic
1034259767 7:149747618-149747640 AAGGAGAAATAGGCCGGGCATGG + Intergenic
1034623397 7:152473558-152473580 ATGGAAATAATGGCTGAGCACGG + Intergenic
1034679203 7:152915798-152915820 AAGGAGAAGGAGGGTGAGAAGGG - Intergenic
1034681784 7:152934339-152934361 ATGGAGCATGAGGCAGAGCTCGG + Intergenic
1035265436 7:157688410-157688432 AGGGACCCAGAGGCTGAGCAGGG + Intronic
1035422979 7:158744652-158744674 CAGGAAAAAGAGGCTGGGCATGG - Intronic
1036437263 8:8746015-8746037 AAAGTGAAAGAGGCTGGGCACGG + Intergenic
1036628909 8:10496604-10496626 AGGGAGGAGGAGGCTGGGCAGGG + Intergenic
1036652768 8:10655587-10655609 GTGGAGAAAATGGCTGAGGACGG - Intronic
1036990334 8:13585271-13585293 ATGAAGAAATAGGCCTAGCATGG + Intergenic
1037497639 8:19455717-19455739 CTGGAGCAGGAGGCTGAGTAGGG - Intronic
1037586415 8:20279694-20279716 AAAAAAAAAGAGGCTGAGCATGG + Intronic
1037743701 8:21627117-21627139 ATGGATCAAGAGCCTGTGCAAGG + Intergenic
1037895566 8:22651456-22651478 ATGAAGAAAGAGGAGGATCAGGG - Intronic
1037923091 8:22821683-22821705 AGGGAGAAAGAGGCTGAGGAGGG + Intronic
1038009455 8:23463216-23463238 AAGAAGAAAGAGGCCGGGCATGG - Intergenic
1038018520 8:23534241-23534263 AAAAAGAAAGAGGCTGGGCATGG - Intronic
1038181419 8:25232308-25232330 ATGCAGAACAAGGCTGAGCTAGG + Intronic
1038548537 8:28444919-28444941 ATGAAGAAATAGGCCGGGCACGG - Intronic
1039331695 8:36544450-36544472 ATGGGCAAAGGGGCTGGGCATGG + Intergenic
1039455358 8:37702365-37702387 TAGGAGAAAGAGGCGGAGGAGGG - Intergenic
1039582770 8:38680582-38680604 ATGGAGAAAGACGTTAAGGAAGG + Intergenic
1039635430 8:39159560-39159582 AGGAAGAAAGAGGCTGAGGAAGG - Intronic
1039911380 8:41829412-41829434 ATGCAGAAAGAGGCTCAGAGAGG + Intronic
1040724746 8:50369304-50369326 AAAGAAAAAGAGGCTGGGCACGG + Intronic
1041680371 8:60582936-60582958 GTGGAAAAATAGGCTGGGCATGG - Intronic
1042206095 8:66331283-66331305 ATGCAGGAAGGGGCTAAGCAAGG - Intergenic
1042247678 8:66724268-66724290 AAGGAGAAATAGGCTGGGTATGG - Intronic
1042545018 8:69943597-69943619 ATGGAAAAATAGGCCGGGCACGG + Intergenic
1043975175 8:86577056-86577078 ATTGAGAAACAGACAGAGCAGGG - Intronic
1044489878 8:92800800-92800822 ATGGAAAAAGGGGCTGGGCGCGG - Intergenic
1044523320 8:93224386-93224408 ATGGAGGAAGCGGGTCAGCAGGG - Intergenic
1044571497 8:93723939-93723961 ATAGAGAAAGAGGCCAAGCGTGG + Intronic
1044642798 8:94402542-94402564 TTGGAAAAATAGGCTGGGCATGG - Intronic
1044650656 8:94491021-94491043 AAGGAAAATAAGGCTGAGCACGG + Intronic
1045004911 8:97909221-97909243 AAGTTGAAAGAGGCTGGGCATGG - Intronic
1045023288 8:98063038-98063060 AGAGAGAAAGAGGCTGGGCGCGG - Intergenic
1045072521 8:98523663-98523685 ATGGGCAAAGGGGCTGGGCATGG - Intronic
1045281001 8:100749702-100749724 ATGGAGGAAGAGGAGGAGAACGG + Intergenic
1045288344 8:100811152-100811174 GTGCAAAAAGAGGCTGGGCACGG - Intergenic
1045508014 8:102792293-102792315 AGAGAGAGAGAGGCTGGGCACGG - Intergenic
1045959044 8:107945536-107945558 AAGGAAAAAGAAGCCGAGCACGG - Intronic
1046154843 8:110274805-110274827 ACTGGGAAACAGGCTGAGCATGG + Intergenic
1046638161 8:116695734-116695756 GTGGAGTCAGAGACTGAGCAAGG + Intronic
1047456588 8:125018687-125018709 ATTCATAAAGAGCCTGAGCAAGG - Exonic
1047694308 8:127387784-127387806 AAGGAGAAAGAGGTGAAGCAGGG - Intergenic
1047709850 8:127540506-127540528 ATGGAGGATGAGGCCGGGCACGG - Intergenic
1048085821 8:131178338-131178360 AAGTAGAAGGAGGCTGGGCACGG + Intergenic
1048550847 8:135432640-135432662 AAGCAGAAAGAGGCAGAGTAGGG - Intergenic
1048590479 8:135816617-135816639 ATGAAGAAAGAGGCAGAGATTGG + Intergenic
1048932101 8:139323427-139323449 ATGGGGGAAGTGGGTGAGCATGG - Intergenic
1049048222 8:140169891-140169913 ATGCAGAAACTAGCTGAGCATGG - Intronic
1049829437 8:144690946-144690968 ATGGACAAAAGGGCTGGGCAAGG - Intergenic
1049866843 8:144944503-144944525 ATAGAGAACTAGGCTGGGCATGG - Intronic
1050035596 9:1432724-1432746 ATGAAAAAAGTGGCTGGGCACGG + Intergenic
1051194794 9:14552480-14552502 GTGGAGAAAGAAGCCAAGCAGGG + Intergenic
1051524126 9:18023491-18023513 TTGGAGAAAGTGGCTGATCTTGG - Intergenic
1051657122 9:19393816-19393838 AAGGAGAAATAGGCCGGGCAAGG + Intergenic
1052412256 9:28136908-28136930 ATGAACAAAAAGGCTGAGTAAGG + Intronic
1052790791 9:32873906-32873928 AAGGAGAAATGGGCTGTGCAGGG - Intergenic
1052852775 9:33387874-33387896 CTGGAGAAGGACGCTGGGCAGGG - Intronic
1053003805 9:34591570-34591592 TGGCAGAAAGAGGCTGAGCCAGG - Intergenic
1053319079 9:37079591-37079613 AGGGAGAAGGAGGCGGAGCCCGG + Intergenic
1053323377 9:37120184-37120206 AGGGAGAAGGAGGCGGAGCCCGG + Intergenic
1055328345 9:75155772-75155794 ATGTGGAAAGAGCCTGAGCTAGG - Intergenic
1055494189 9:76838352-76838374 ATGCAGGCAGAGGCTGGGCATGG + Intronic
1055559219 9:77505967-77505989 ATGTAAAAAGAGGCTGGGTATGG + Intronic
1055576119 9:77661654-77661676 GGGGACAAACAGGCTGAGCAAGG + Intergenic
1055757041 9:79569289-79569311 AAGTAAAAAGAGGCTGGGCACGG + Intergenic
1055799280 9:80015308-80015330 TAGGACAGAGAGGCTGAGCATGG - Intergenic
1055973249 9:81931892-81931914 ATGGAGATTGAGGTTGAGCCAGG - Intergenic
1055975002 9:81946984-81947006 ATGGAGATTGAGGTTGAGCCAGG - Intergenic
1055980041 9:81992210-81992232 ATGGAGATTGAGGTTGAGCCAGG - Exonic
1056083458 9:83121663-83121685 ATGGAGCATGAGCCAGAGCAGGG - Intergenic
1056146103 9:83730895-83730917 AAGGAGAAAGAGGAGGAGAAGGG + Intergenic
1056604706 9:88076872-88076894 ATGGAGAATGAGGCGGAGCTGGG - Intergenic
1056743989 9:89284051-89284073 ATGGAAAAGGAGGTTGAGAAGGG - Intergenic
1057105899 9:92416393-92416415 ATTGAGAAATAGGCTGGGCGTGG - Intronic
1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG + Intergenic
1057702909 9:97376519-97376541 AGCTAGAAGGAGGCTGAGCAGGG - Intronic
1057766091 9:97920585-97920607 ATGAGGAAAAAGCCTGAGCAGGG - Intronic
1057858824 9:98623979-98624001 ATGGGGCAAGTGGCTGAGCTGGG + Intronic
1057909067 9:99004258-99004280 TTGGAGAAAGAGGCCGGGCTTGG + Intronic
1057928068 9:99170573-99170595 ATGGGGAAACAGGCTGAGAAAGG + Intergenic
1058479786 9:105380154-105380176 ATGGAAAAACAGGCTCAGAATGG + Intronic
1058665492 9:107310822-107310844 ATGAAGAAACAGGCTTAGAAAGG + Intronic
1058935235 9:109763822-109763844 ATGGAGACAGAGGCAGAGATTGG - Intronic
1058946418 9:109861166-109861188 ACAGGGAAAGAGGCTAAGCAGGG - Intronic
1059256826 9:112938513-112938535 ATGGAGAAACAGTCTTAGAAGGG - Intergenic
1059352563 9:113676048-113676070 GTGGAGAAATAGGCTGGGCATGG + Intergenic
1059424403 9:114211609-114211631 ATGGAGAAAGAGCCAAGGCACGG + Intronic
1059543961 9:115157861-115157883 ATGGTCAAATAGGCCGAGCATGG - Intronic
1059585066 9:115597163-115597185 AAGGAGAAAGAGGAGGAGGAGGG - Intergenic
1059672790 9:116507347-116507369 ATGGAGAAACAGGCACAGAAGGG + Intronic
1059757785 9:117309999-117310021 ATGAAGAAACAGGCTCAGAAAGG - Intronic
1059794213 9:117673828-117673850 ATGGTGAAATAGGCTGGGCCAGG - Intergenic
1059910787 9:119041550-119041572 AGGGAGATGGAGGCTGGGCAGGG + Intergenic
1060354716 9:122894587-122894609 ATGAAGAGAGAGGCTGGGCACGG + Intronic
1060444358 9:123674087-123674109 ATGGTGGTAGAGGCTCAGCATGG - Intronic
1060563461 9:124567883-124567905 AAAGAGAAACAGGCTGGGCACGG + Intronic
1060601580 9:124881696-124881718 AGAGAGAAAGGGGCTGGGCAGGG + Intronic
1060809145 9:126600161-126600183 ATGCAGGTAGAGACTGAGCAAGG + Intergenic
1061022007 9:128022008-128022030 ATAGAGACAGAGACTAAGCACGG - Intergenic
1061106282 9:128533131-128533153 ATGATGAAACAGGCTGGGCATGG + Intronic
1061410338 9:130417609-130417631 GTGGAGACAGAGGCAGAGGATGG + Intronic
1061450451 9:130664533-130664555 ATGGAGAAGGAACCAGAGCAGGG - Intergenic
1061727718 9:132590482-132590504 ATGGAGACAGAGGAGGAGGAGGG - Intergenic
1062219213 9:135405223-135405245 ATGCTGAGAGGGGCTGAGCATGG - Intergenic
1185548545 X:965668-965690 ATGGAGATAGAGGCAGAGACTGG - Intergenic
1185677109 X:1857984-1858006 ATGGAGACAGAGGCAGAGACTGG - Intergenic
1185735442 X:2492328-2492350 ATGGAGACAGAGGCCGAGACTGG + Intronic
1186021162 X:5256944-5256966 AAGGAGAAAGAGGGAGAGAAAGG + Intergenic
1186196724 X:7116535-7116557 ATGGTGAATGAGGCTGAGCAGGG - Intronic
1186202128 X:7165356-7165378 AAGGAGTAACAGGCTGGGCATGG + Intergenic
1186549806 X:10491537-10491559 TTTGAAAAAGAGGCTGGGCATGG - Intronic
1186578344 X:10790361-10790383 ATGGATAAGGAAGCAGAGCACGG - Intronic
1186878383 X:13839569-13839591 AACCAGAAAGAGGCTGAGCCAGG - Intronic
1187245872 X:17552527-17552549 AGGGAGAAAGAAGATGAGGAAGG + Intronic
1187319590 X:18227755-18227777 AAGGGGAGACAGGCTGAGCATGG + Intergenic
1187326891 X:18299221-18299243 GTGGACAAAGGGGCTGGGCAAGG + Intronic
1187378924 X:18782820-18782842 AGGCAGAGGGAGGCTGAGCACGG + Intronic
1187723495 X:22176614-22176636 ATGGAGATAGACGCAGAGGAAGG - Intronic
1187758562 X:22553649-22553671 CAGGAGAAAGAGGCTGGGAAGGG + Intergenic
1187768447 X:22668926-22668948 ATGGAGAAATAAACTGAGCAAGG - Intergenic
1187786583 X:22894955-22894977 AGAGAGAAAAAGGCTGAGGATGG - Intergenic
1188029209 X:25245716-25245738 ATGAAGAGAGAGGCTGGGCATGG - Intergenic
1188215875 X:27476401-27476423 AATTAGAAAGAGGGTGAGCAGGG + Intergenic
1188951391 X:36379100-36379122 ATGCACAAAGAGGCTGGGCGTGG - Intronic
1189277443 X:39797292-39797314 AGGGAGGGAGAGGCTGGGCAGGG - Intergenic
1189507222 X:41623998-41624020 ATGGAGCTAAAGGCTGGGCATGG - Intronic
1190087687 X:47409937-47409959 ATGAAGAAGGAGGCTGGGCGCGG - Intronic
1190226067 X:48546221-48546243 AAAAAAAAAGAGGCTGAGCACGG + Intronic
1190328357 X:49220493-49220515 GTGGAGAAAGAGGAAGAGGAGGG - Exonic
1190930972 X:54949567-54949589 ATGGAGAGATAGACTGTGCATGG - Intronic
1191752279 X:64555880-64555902 ATGGAGCTAGAGGCTGAGGTGGG + Intergenic
1192124784 X:68491769-68491791 ATGGGGATATAGGCTGGGCACGG - Intergenic
1192317625 X:70065464-70065486 ATGGACAAAGAGGCCCAGCTGGG + Intergenic
1192317709 X:70065766-70065788 AAGGAGGAATAGGCTGACCAGGG + Intergenic
1192822941 X:74663717-74663739 AGGCAGGAAGAGGCTGGGCATGG + Intergenic
1193108896 X:77707452-77707474 ATGGGCAAAGGGGCTGGGCACGG + Intronic
1193164433 X:78264624-78264646 ATGGAGAATGAGGAAAAGCAGGG - Intergenic
1193380885 X:80814664-80814686 ATGAAGTATAAGGCTGAGCATGG + Intergenic
1193384455 X:80854285-80854307 ATGAAGAAAGAGGCTGGGCATGG - Intergenic
1193801122 X:85937544-85937566 ATGGAAAATCAGGCTGGGCATGG + Intronic
1194403207 X:93462594-93462616 ATGGAGAAAGAAGGTGAAGAGGG + Intergenic
1194717066 X:97298906-97298928 AAGGACTAAGAGGCTGGGCACGG - Intronic
1194812559 X:98403891-98403913 ATGGTTAAAGAGACTAAGCAAGG - Intergenic
1194984778 X:100478530-100478552 AAGGATAAAGAGGCTGGGGAGGG - Intergenic
1195068752 X:101260184-101260206 ATGGAGAAAGGGGCTGGGAAAGG - Intronic
1195119481 X:101736024-101736046 ATTTAGAAAGAGGCTGGGCATGG - Intergenic
1195272162 X:103242685-103242707 CTGGAGAAAGAGGGTCAGGAGGG - Intergenic
1195369720 X:104161557-104161579 AAGAAGAAAGAGGCTGGGCGTGG + Intergenic
1195601045 X:106749396-106749418 AGGGAAAAAGAGGCTCAACAAGG + Intronic
1195620327 X:106946930-106946952 TTGAAGAAAGAAGCTGGGCATGG - Intronic
1196083417 X:111658492-111658514 ATGCAGAAGGATGCTGGGCATGG + Intergenic
1196321561 X:114346467-114346489 ATCTAGAAATAGGCTGGGCATGG - Intergenic
1196731717 X:118947582-118947604 ATGGAGAATCAGGCTGGGCATGG + Intergenic
1196769797 X:119282101-119282123 ATGGAGAGGGAGGCCGGGCACGG - Intergenic
1196850340 X:119931746-119931768 ATGAAGAAATAAGCTGAACATGG + Intronic
1197067284 X:122248499-122248521 TTGGACAAACAGGCTAAGCATGG - Intergenic
1197359691 X:125485099-125485121 ATACAAAAAGAAGCTGAGCAGGG - Intergenic
1198161993 X:134017218-134017240 AAAGAAAAAGAGGCTGGGCATGG - Intergenic
1198323687 X:135545073-135545095 ATGGAGTAAGGGGCAGAGGAAGG - Intronic
1198641878 X:138765112-138765134 ATGAAGAAAGAGGCTCAGTGAGG - Intronic
1199319853 X:146425529-146425551 ATGGAGAAAGAGAGTGAGATAGG + Intergenic
1199399318 X:147378036-147378058 AAGGAGCAAGGGGCTAAGCATGG - Intergenic
1199764704 X:150932663-150932685 TTGGAGGGAGAGACTGAGCATGG - Intergenic
1199802855 X:151268566-151268588 ATGAAGAGAGGGGCTGAGAATGG + Intergenic
1199850856 X:151724240-151724262 AGAGAGAAAGAGGTGGAGCAGGG - Intergenic
1200113004 X:153752698-153752720 AATAAGAAAGAGGCTGGGCATGG + Intergenic
1200979515 Y:9248802-9248824 AAGGAGAAAGAGGATGGTCAAGG + Intergenic
1201062322 Y:10058711-10058733 AAGGAGAAAGAGGATGGTCAAGG - Intergenic
1201239511 Y:11945163-11945185 ATGGAGACAGAGGCAGAGACTGG + Intergenic
1201569385 Y:15398058-15398080 ATTGTGAATGTGGCTGAGCATGG - Intergenic
1202271007 Y:23073885-23073907 AGGGCGAAGGATGCTGAGCATGG + Intergenic
1202295019 Y:23346797-23346819 AGGGCGAAGGATGCTGAGCATGG - Intergenic
1202424002 Y:24707629-24707651 AGGGCGAAGGATGCTGAGCATGG + Intergenic
1202446787 Y:24962456-24962478 AGGGCGAAGGATGCTGAGCATGG - Intergenic