ID: 1143367857

View in Genome Browser
Species Human (GRCh38)
Location 17:6420190-6420212
Sequence CTCTGCTCCCTGCATCCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 720
Summary {0: 1, 1: 0, 2: 5, 3: 98, 4: 616}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143367849_1143367857 27 Left 1143367849 17:6420140-6420162 CCCCTGAGGAGCTGGAGACACTG 0: 1
1: 0
2: 6
3: 45
4: 380
Right 1143367857 17:6420190-6420212 CTCTGCTCCCTGCATCCTGGTGG 0: 1
1: 0
2: 5
3: 98
4: 616
1143367850_1143367857 26 Left 1143367850 17:6420141-6420163 CCCTGAGGAGCTGGAGACACTGT 0: 1
1: 2
2: 3
3: 15
4: 218
Right 1143367857 17:6420190-6420212 CTCTGCTCCCTGCATCCTGGTGG 0: 1
1: 0
2: 5
3: 98
4: 616
1143367851_1143367857 25 Left 1143367851 17:6420142-6420164 CCTGAGGAGCTGGAGACACTGTG 0: 1
1: 2
2: 2
3: 30
4: 372
Right 1143367857 17:6420190-6420212 CTCTGCTCCCTGCATCCTGGTGG 0: 1
1: 0
2: 5
3: 98
4: 616
1143367853_1143367857 -9 Left 1143367853 17:6420176-6420198 CCTCCTCGGCTCTCCTCTGCTCC 0: 1
1: 0
2: 6
3: 78
4: 827
Right 1143367857 17:6420190-6420212 CTCTGCTCCCTGCATCCTGGTGG 0: 1
1: 0
2: 5
3: 98
4: 616

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143367857 Original CRISPR CTCTGCTCCCTGCATCCTGG TGG Intronic