ID: 1143370676

View in Genome Browser
Species Human (GRCh38)
Location 17:6437087-6437109
Sequence CCTTCTCAGGGGAAGTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143370667_1143370676 10 Left 1143370667 17:6437054-6437076 CCAACTGAAATGAGAAAATTGAC No data
Right 1143370676 17:6437087-6437109 CCTTCTCAGGGGAAGTTGGGAGG No data
1143370666_1143370676 11 Left 1143370666 17:6437053-6437075 CCCAACTGAAATGAGAAAATTGA No data
Right 1143370676 17:6437087-6437109 CCTTCTCAGGGGAAGTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143370676 Original CRISPR CCTTCTCAGGGGAAGTTGGG AGG Intergenic
No off target data available for this crispr