ID: 1143370676 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:6437087-6437109 |
Sequence | CCTTCTCAGGGGAAGTTGGG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1143370667_1143370676 | 10 | Left | 1143370667 | 17:6437054-6437076 | CCAACTGAAATGAGAAAATTGAC | No data | ||
Right | 1143370676 | 17:6437087-6437109 | CCTTCTCAGGGGAAGTTGGGAGG | No data | ||||
1143370666_1143370676 | 11 | Left | 1143370666 | 17:6437053-6437075 | CCCAACTGAAATGAGAAAATTGA | No data | ||
Right | 1143370676 | 17:6437087-6437109 | CCTTCTCAGGGGAAGTTGGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1143370676 | Original CRISPR | CCTTCTCAGGGGAAGTTGGG AGG | Intergenic | ||
No off target data available for this crispr |