ID: 1143371637

View in Genome Browser
Species Human (GRCh38)
Location 17:6444239-6444261
Sequence CCACGAGGCTGGCGGCGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 333}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143371637 Original CRISPR CCACGAGGCTGGCGGCGGGG CGG Intergenic
900114560 1:1022990-1023012 CCACCAGGCTGGGGTCAGGGAGG - Intronic
900603146 1:3511763-3511785 GCCCGAGGCTGGCTGCTGGGTGG - Intronic
900658144 1:3770303-3770325 CCAGGAGGCTGTGGCCGGGGTGG - Intronic
901837627 1:11934626-11934648 CCACTAGGCAGGCGCGGGGGAGG + Intronic
903175396 1:21577423-21577445 CCACGAGACCCACGGCGGGGAGG + Exonic
903907379 1:26696421-26696443 CCAGGCTGCTGGCGGCGGCGGGG - Exonic
906026921 1:42682118-42682140 CCACGAGGCAGCCGCCGGGCTGG - Intergenic
906207944 1:43996985-43997007 ACCCGAGGCTGGGGGCGAGGAGG + Intronic
906290645 1:44617398-44617420 TCACGAGGGCGGCGGCGGGCCGG - Intronic
908508458 1:64829499-64829521 CCAAGAGGCTGGAGACTGGGAGG + Intronic
909001372 1:70221456-70221478 CCCCGCGGCGTGCGGCGGGGCGG + Intronic
909640895 1:77869739-77869761 CCGGGAGGCAGGCGGGGGGGGGG - Intronic
911612287 1:99970197-99970219 CCAGGAGGCTAGCGGCTGCGGGG + Intronic
912212583 1:107570989-107571011 CCACGGGGCTGGCGGGCGGGGGG + Intergenic
913994215 1:143638868-143638890 CCGGGAGGGAGGCGGCGGGGGGG + Intergenic
920100492 1:203514119-203514141 CCTCTAGCTTGGCGGCGGGGGGG + Intergenic
920255633 1:204652272-204652294 CAAGGAGGAAGGCGGCGGGGGGG - Intronic
921177856 1:212609196-212609218 GCTCGAGGCTGGCGGCAGAGTGG - Intronic
923372653 1:233328328-233328350 GCGCGGGGCTGGCGGCCGGGCGG - Exonic
924738361 1:246779640-246779662 CCAAGAGGCTGGCGGTGGCCTGG - Intergenic
1063671527 10:8103382-8103404 GCCCGAGGCTGGAGGCGGGGGGG + Intergenic
1065186526 10:23174610-23174632 CCGCGAGGCCGGCGGGGCGGGGG - Intergenic
1065619402 10:27565027-27565049 GCCAGAGGCTGGCGGCGGGGAGG - Intergenic
1066747564 10:38616191-38616213 CCAGGAGGCGGGGGGTGGGGGGG + Intergenic
1071086791 10:81875146-81875168 CCGAGAGGCGGGCGGCGGGCGGG - Intergenic
1071598135 10:86942719-86942741 CCACGACGCGGGCCGCGAGGAGG - Exonic
1072253698 10:93601131-93601153 CCTCGGGGCCGGCGGCGGGATGG - Intronic
1072926280 10:99620200-99620222 CCGGGGGGCCGGCGGCGGGGAGG - Exonic
1073059303 10:100723975-100723997 CCGCGAGGTGGGGGGCGGGGCGG + Intergenic
1073156891 10:101354331-101354353 GGCCGAGGCTGGCGGCGGAGCGG + Intronic
1074503198 10:114044236-114044258 CAACGAGGCGGGCGGCGACGCGG - Exonic
1076046839 10:127300909-127300931 CCACGAGGCCGGCAGCCGGGAGG + Intronic
1076721979 10:132396862-132396884 CCACGAGCCCGGGGGCGGCGGGG - Intergenic
1077165067 11:1131139-1131161 CCACGAGGCAGGCAGGGGAGGGG + Intergenic
1078087500 11:8243033-8243055 CCACGGGGCTGGGTGAGGGGAGG + Intronic
1078246139 11:9574239-9574261 GGACGAGGCGGGCGGTGGGGCGG + Exonic
1083246049 11:61429420-61429442 GCGCGAGGCCGGGGGCGGGGCGG - Intronic
1083448514 11:62727006-62727028 GGACGAGGCCGGCGGCGGCGGGG - Exonic
1083633858 11:64109647-64109669 CCTCCAGGCTGGGGGCAGGGTGG - Intronic
1083779686 11:64911345-64911367 CCACCAGGCTGGGGGTTGGGAGG + Intronic
1084207041 11:67601231-67601253 ACACCAGGATGGCGGCGCGGAGG + Intergenic
1084313450 11:68330227-68330249 ACAAGGGGCTGGGGGCGGGGTGG - Intronic
1084406804 11:68979023-68979045 CCTCGAGGCTGGATGCTGGGTGG + Intergenic
1084412807 11:69013926-69013948 CCTGGAGGCGGGCGGTGGGGGGG + Intergenic
1084978108 11:72814338-72814360 CCAGGGGGCGGGCGGCGGCGGGG - Exonic
1085284642 11:75351758-75351780 CGACGCGGCGGGCGGCGGGCGGG - Intergenic
1086437977 11:86800456-86800478 CCCCGAGGCCGGAGGCGGGGCGG + Exonic
1087130879 11:94668509-94668531 CCAGGGGGCTGGGGGCCGGGGGG - Intergenic
1088530363 11:110801519-110801541 ACAGGAGGCTGGAGGCGGAGTGG - Intergenic
1088597163 11:111449318-111449340 TCACTGGGCTGGGGGCGGGGAGG - Intronic
1088764379 11:112962000-112962022 CCCAAAGGCGGGCGGCGGGGCGG + Intronic
1090029745 11:123196190-123196212 CCAGGAGGCTCGCGGAGGGCAGG + Intergenic
1090029750 11:123196208-123196230 GCAGGAGGCTGGCGGCCGGACGG + Intergenic
1090187355 11:124747097-124747119 CCAGGAGCCCGGCGGGGGGGAGG - Exonic
1090429968 11:126637463-126637485 GCAGGAGGCTGGAGGCTGGGAGG - Intronic
1092020797 12:5200730-5200752 CCACGGGGTCGGGGGCGGGGAGG + Intergenic
1093609577 12:21137541-21137563 CAGCGAGGCTGGGGGAGGGGCGG - Intronic
1094199324 12:27780459-27780481 CCAGGAGGCCGGCGGCCCGGAGG + Exonic
1095261608 12:40105349-40105371 CCAGGAGGATGGCAGCGCGGCGG + Exonic
1098228645 12:68350588-68350610 CCACAAAGTTGGCGGGGGGGGGG - Intergenic
1103561114 12:121793682-121793704 CCAAGAGGTCGGGGGCGGGGCGG + Exonic
1103595557 12:122022577-122022599 CCGCGATGCCGGCGGCGGCGGGG + Intronic
1104623931 12:130337910-130337932 ACACGAGGCCGGCGCCCGGGAGG + Exonic
1104756991 12:131275634-131275656 CCTGGAGGCTGGAGGCTGGGTGG - Intergenic
1104846921 12:131851531-131851553 GGAGGAGGCTGGCGGCGGTGCGG - Exonic
1104967504 12:132515014-132515036 CCACAAGGCTGACAGCAGGGAGG + Intronic
1105247317 13:18665580-18665602 CCTCGAAGCAGGCGGCGCGGAGG - Intergenic
1106110400 13:26771928-26771950 GCACGAGCCTGGTGGCAGGGCGG + Intergenic
1107998879 13:45888551-45888573 CCAGGAGCCTGGGGGAGGGGAGG + Intergenic
1108292690 13:48976548-48976570 CTACGCGGCTCGCCGCGGGGAGG - Intronic
1112012054 13:95301054-95301076 CCACGCGGCCGGCGTGGGGGCGG + Intronic
1112508468 13:99989382-99989404 CCACGAAGTTCGGGGCGGGGAGG + Intergenic
1112574946 13:100627285-100627307 CCACGAGGCCGGCGCGGGGCGGG + Intronic
1114454410 14:22845877-22845899 GGACGAGGAGGGCGGCGGGGCGG + Exonic
1114483339 14:23048360-23048382 CGACGAGGGCGGCGGCGAGGAGG - Exonic
1115651214 14:35404133-35404155 CCTCTAGGCCGGGGGCGGGGCGG - Intronic
1115664480 14:35533449-35533471 CTCGGAGGCTGGCGGCGGGCAGG + Intergenic
1115869723 14:37786329-37786351 CAACGAGGCTGGGTGAGGGGCGG - Intronic
1117920261 14:60721596-60721618 CAACTGGGCCGGCGGCGGGGTGG + Intronic
1118220713 14:63852926-63852948 CCCGGAGGCGGGCGGCGGGCGGG + Intergenic
1118314244 14:64716039-64716061 CCACGAGGGTGGCGAGGGGCCGG - Intronic
1119026354 14:71155906-71155928 CAATGAGGATGGGGGCGGGGTGG + Intergenic
1121108548 14:91296509-91296531 CCACGGGGGTGGAGGCGGGATGG - Intronic
1121144774 14:91574246-91574268 CCCCGAGGCAGGGCGCGGGGCGG - Intergenic
1122157570 14:99759428-99759450 CCTCCAGGCTGGCTGAGGGGTGG - Intronic
1122602421 14:102928347-102928369 CCAGGGGACTGGGGGCGGGGTGG + Intronic
1122617751 14:103032066-103032088 CCACAAGGCTGGCCGCCGGCTGG - Intronic
1122872075 14:104643394-104643416 ACACGAGGCTGGGGGGCGGGTGG - Intergenic
1122900584 14:104780720-104780742 CCTGGTGGGTGGCGGCGGGGCGG - Intronic
1123043590 14:105500499-105500521 CCATGATGCTGGCGGTGGAGAGG + Intergenic
1124155918 15:27225332-27225354 CCACGTGGAGGGGGGCGGGGAGG - Intronic
1124439242 15:29674940-29674962 CAGCGGGGCTGGCGGAGGGGCGG - Intergenic
1124477041 15:30044593-30044615 CGCCGGGCCTGGCGGCGGGGGGG - Intergenic
1124484653 15:30103772-30103794 CCACGAGGGTCACGGCGGCGGGG + Intergenic
1124500778 15:30225216-30225238 CCAGGGGGCTGGCGGGGGGCGGG - Intergenic
1124518928 15:30393466-30393488 CCACGAGGGTCACGGCGGCGGGG - Exonic
1124539728 15:30572780-30572802 CCACGAGGGTCACGGCGGCGGGG + Intergenic
1124684630 15:31771665-31771687 CCAGGAGGCTGGGGTCAGGGTGG - Intronic
1124742792 15:32313451-32313473 CCAGGGGGCTGGCGGGGGGCGGG + Intergenic
1124758924 15:32434802-32434824 CCACGAGGGTCACGGCGGCGGGG - Intergenic
1125665435 15:41426708-41426730 TCAGGAGGCCGGCGGGGGGGGGG - Intronic
1125699120 15:41665474-41665496 CCTCGAGCCTGGGGGTGGGGAGG - Intronic
1127922546 15:63504715-63504737 CCACGAGGAGGGCAGCTGGGAGG - Exonic
1129321512 15:74777597-74777619 CAAAGAGGCTGGGGGAGGGGAGG + Intergenic
1129348281 15:74938166-74938188 CCGCGCGGCCGGCGGCGGCGGGG + Exonic
1129868936 15:78928809-78928831 TCAGCAGGCTGGCGGCAGGGTGG + Intronic
1132503822 16:297025-297047 CCACGAGGCTGGCTGCGTGCGGG + Intronic
1136402253 16:30025138-30025160 CCACGGGGGTGGGGGTGGGGAGG + Exonic
1136672909 16:31874053-31874075 CCCCGAGGCTGACTGCGGGGAGG - Intronic
1136912634 16:34157267-34157289 TCACGAGGCAGGGGGTGGGGTGG + Intergenic
1136927688 16:34389314-34389336 CCTGGAGGCAGGCTGCGGGGTGG - Intergenic
1136976886 16:35022492-35022514 CCTGGAGGCAGGCTGCGGGGTGG + Exonic
1137979085 16:53054845-53054867 CCACAGGGCTGGCGGCGCGCTGG + Intergenic
1138198896 16:55074428-55074450 CCAGGAGGGTGGCGGTGGGAAGG + Intergenic
1139691874 16:68646357-68646379 CCCAGACGCTGGGGGCGGGGTGG - Intronic
1140111002 16:72004802-72004824 CCATGATGCTGGCGGGGGTGCGG + Intergenic
1141671765 16:85495852-85495874 CCAGGAGGCTGGAGGTGGGGAGG + Intergenic
1142374900 16:89701727-89701749 CCGTGACGCTGGGGGCGGGGCGG + Intergenic
1142617996 17:1147809-1147831 CCATGAGGCTGGCGTGGGTGGGG - Intronic
1143371637 17:6444239-6444261 CCACGAGGCTGGCGGCGGGGCGG + Intergenic
1143419294 17:6776367-6776389 CCCCGAGGCCCGCGGCGGGGAGG + Intronic
1144696197 17:17305401-17305423 CCACGTGTGTGGGGGCGGGGGGG - Intronic
1144701951 17:17346142-17346164 CCACGAGGCTGGGGAGGGTGGGG - Intronic
1146062009 17:29612637-29612659 GCAGGAGGCTGGGGGCGCGGGGG - Exonic
1147132622 17:38418263-38418285 CCCCGAGGTGGGCGGTGGGGTGG - Intergenic
1147184232 17:38705130-38705152 CCCGGCGGCTGGCGGCGGGCGGG + Intergenic
1147250783 17:39151525-39151547 CCCCGGGGCTGGCGGAGGGGCGG + Exonic
1147412683 17:40264933-40264955 CCAGGAGGCTGGCGGTAAGGCGG - Exonic
1147658592 17:42105087-42105109 CCACGAGTGTGGCGGAGGAGGGG - Exonic
1147793037 17:43025174-43025196 CCGCCTGGCTGGGGGCGGGGCGG + Intergenic
1148323799 17:46771968-46771990 CCGCGAGTCTGGGGGCGGCGGGG - Intronic
1148691615 17:49530503-49530525 CCAGGGGGTTGGCGGAGGGGAGG - Intergenic
1150217336 17:63477842-63477864 CCACGGTGCTGGGGGAGGGGAGG - Intergenic
1150459299 17:65333891-65333913 CCAGGAGGCTGGCAGCATGGTGG + Intergenic
1152077615 17:78168927-78168949 GCGCGAGGCTGGGGGTGGGGTGG - Intronic
1152110804 17:78356727-78356749 GCACGGGGCGGGGGGCGGGGGGG + Intergenic
1152151559 17:78604362-78604384 CCACCAGGCTGGCGCTGGGGAGG - Intergenic
1152363760 17:79843989-79844011 CCGCGAGGCTGGGAGCTGGGAGG - Intergenic
1152581295 17:81166491-81166513 CACGGAGGCTGGCGGGGGGGGGG + Intergenic
1152641788 17:81452361-81452383 GCAGGAGGCTGGCCGCAGGGTGG + Intronic
1153219139 18:2847104-2847126 CCACAAGGCTGCCGGCGGCCAGG - Exonic
1153854926 18:9136609-9136631 CCAAGCGGCAGGCGGCGGAGGGG - Intronic
1154441522 18:14393541-14393563 CCTCGAAGCAGGCGGCGCGGAGG + Intergenic
1155253882 18:23977924-23977946 TCAGGAGGCTGGGGGCTGGGTGG - Intergenic
1155986220 18:32233502-32233524 CAGCGAGGCTGGGGGAGGGGCGG - Intronic
1156325533 18:36071506-36071528 CCAAGGGGCTGGGGGCGGGGGGG + Intergenic
1158397129 18:57088222-57088244 CCACAGGGCTGGGGGCGCGGGGG + Intergenic
1158649416 18:59272937-59272959 CGCCGGGGCTGGCGGCGGGGAGG + Exonic
1158857133 18:61554287-61554309 CGACGAGGGCGGCGGCGAGGAGG + Exonic
1159927645 18:74283137-74283159 CCACGAGGTTGGTTGCAGGGTGG - Intronic
1160015880 18:75140342-75140364 GCAGGAGGCTTGCGGCTGGGAGG - Intergenic
1160584359 18:79904310-79904332 CCCCCAGGCAGTCGGCGGGGAGG + Intronic
1160613954 18:80109709-80109731 CCACGTGACCGGCGGCGGGCGGG - Intronic
1160680376 19:409277-409299 CCCGGAGGCTGGTGGCAGGGAGG + Intergenic
1160864835 19:1251990-1252012 CCAGGAGGCTGGGGGAGGGGAGG + Intronic
1160915177 19:1492966-1492988 CCAGGAGGCAGGCAGCAGGGAGG + Intronic
1160947677 19:1651279-1651301 CTCCGAGGCTGGGGGTGGGGAGG + Intronic
1160971207 19:1768562-1768584 CCACCAAGCTGGCGGAGGAGTGG - Intronic
1161210362 19:3062427-3062449 CGGGGAGGCGGGCGGCGGGGAGG - Intronic
1161299247 19:3534930-3534952 CCCCGAGGAAGGCGGCTGGGCGG + Intronic
1161379807 19:3958968-3958990 CCACCAGGCTGGAGGCGGAGTGG - Exonic
1161729050 19:5947733-5947755 CCACGTCCCTGCCGGCGGGGTGG + Intronic
1162451413 19:10757368-10757390 CCCAGTGGCTGGCGTCGGGGGGG - Intronic
1162578561 19:11513775-11513797 CCAGGAGGCTGGCGCAGGGTGGG - Intronic
1162953570 19:14085866-14085888 CCAGGAACCTGGCGGTGGGGAGG + Intronic
1163446790 19:17351684-17351706 CCAGGAGGCTGGAGGAGGGGAGG + Exonic
1163623524 19:18374644-18374666 GCACGGGGGTGGGGGCGGGGGGG + Intergenic
1163651525 19:18521026-18521048 CCACCTGGCTGGTGGTGGGGAGG - Intronic
1163786438 19:19277239-19277261 CCCCGGGGCGGGCGGGGGGGGGG + Intronic
1164644051 19:29845068-29845090 CCGCGGGGCCTGCGGCGGGGTGG + Intergenic
1165825813 19:38705186-38705208 CCAAGAGGCAGGCAGCTGGGAGG - Intronic
1166106574 19:40600829-40600851 GCAGGAGGCTGGAGGTGGGGGGG - Intronic
1166524972 19:43504920-43504942 CCACGAGGGTGGGGCCGGGCCGG - Exonic
1166798109 19:45440128-45440150 CAGCCAGGCTAGCGGCGGGGCGG - Intronic
1167019049 19:46860983-46861005 CCTCGGGGCGGGGGGCGGGGAGG - Intergenic
1167903251 19:52637844-52637866 CCACGAGGAGGGAGGTGGGGGGG + Intronic
1168100867 19:54140252-54140274 CCACAAGGCGGGTGGCGGGGTGG - Intronic
1168282604 19:55313427-55313449 GTCCGAGGCTGGCGGCAGGGAGG - Intronic
1168335042 19:55592779-55592801 CCACGGTGAGGGCGGCGGGGAGG - Exonic
925060411 2:885914-885936 CCACAAGGCTGCAGCCGGGGAGG + Intergenic
925370691 2:3343164-3343186 CCACAGGGCAGGTGGCGGGGCGG - Intronic
925535991 2:4917224-4917246 TACCGAGGTTGGCGGCGGGGAGG - Intergenic
925830006 2:7884471-7884493 CCAGGAGCCTGGGGGTGGGGAGG + Intergenic
926717963 2:15939879-15939901 CTACGAGGGTGGCGCCGCGGTGG - Intergenic
926738791 2:16094177-16094199 CCACGACGCTGCCGGCCAGGTGG - Intergenic
928728247 2:34201120-34201142 CCCCGAGGTTGGAGGTGGGGAGG + Intergenic
929031872 2:37656994-37657016 CCTCGAGGATGGCGGGGGGCGGG - Intronic
931809473 2:65840930-65840952 CCAGGAGGTTGGGGGTGGGGTGG - Intergenic
932586942 2:73036339-73036361 CCAGGAGGCTGGGGGAAGGGAGG + Intronic
932763746 2:74457562-74457584 GCACGGGGCGAGCGGCGGGGAGG + Exonic
933722832 2:85409303-85409325 CCATGGGGCTGGGGGAGGGGAGG + Intronic
935046639 2:99489526-99489548 CCATGGGGCTGGCGGCGGCGCGG + Intronic
935046720 2:99489786-99489808 CCCCCGGGCCGGCGGCGGGGTGG - Intronic
935371949 2:102356364-102356386 CCCCGAGGCTGGGGCGGGGGCGG - Exonic
935739174 2:106131314-106131336 CAACGAGGCTGGGGGAGGGGCGG + Intronic
936412880 2:112275936-112275958 CTGCGAGGCCGGCGGCGGCGGGG - Exonic
937123095 2:119454225-119454247 CCAGGAGGCAGGCGGCAGAGTGG + Intronic
937304397 2:120862335-120862357 GCAGGAGCCTGGCGGAGGGGTGG - Intronic
937450914 2:122001442-122001464 CCACGGGTCTGGGGGCTGGGAGG - Intergenic
937693920 2:124786687-124786709 CCACAGGGCTGGCGTAGGGGAGG + Intronic
938089664 2:128423102-128423124 TCTGGAGGCTGGGGGCGGGGTGG + Intergenic
938099191 2:128486614-128486636 CCGCGTGGCCGGGGGCGGGGTGG + Intergenic
939105322 2:137942187-137942209 CCAGGAGGCTGGGGGTGGAGAGG + Intergenic
939612954 2:144332347-144332369 CCGCGAGGCGGGCGCCGGGGAGG + Intronic
943767597 2:191678804-191678826 CCACGTGGGTGGGGGAGGGGAGG - Intronic
946247165 2:218394463-218394485 CCAGGAGGCAGGAGGTGGGGAGG + Intronic
946751041 2:222896202-222896224 CCGGGAGGGAGGCGGCGGGGGGG - Intronic
948483124 2:238262802-238262824 CCAGGAGGGAGGCGGCGAGGCGG + Intronic
948663650 2:239521494-239521516 TCACGGGGCTGGAGGCGGGAGGG - Intergenic
948753394 2:240145029-240145051 CCAGGGGGATGGGGGCGGGGTGG - Intergenic
948778905 2:240305005-240305027 CCACGTGGCTGGAGGAGGTGAGG - Intergenic
949080099 2:242089284-242089306 CCAGGAGGGTGGGGGCGGGAAGG - Intergenic
1168756864 20:324518-324540 GCACGAGGCGCGTGGCGGGGAGG - Intergenic
1168943901 20:1735816-1735838 GCAGGAGGCTGGCAGCGGCGTGG + Intergenic
1171341333 20:24431573-24431595 CTGGGAGGCTGTCGGCGGGGAGG - Intergenic
1173279903 20:41618617-41618639 GCACGAGGCAGGGGGCGGGGCGG - Intergenic
1173705279 20:45105722-45105744 CCAAGAGCCTGGGGGTGGGGTGG + Intergenic
1175173097 20:57093331-57093353 CCACGAGGCTGGTGGGAGGGTGG + Intergenic
1175349817 20:58309798-58309820 CCACGCGGCTGGCAGCGGACAGG + Exonic
1175439589 20:58981348-58981370 CGACGAGGCTGACGGCGGCCAGG + Exonic
1175856481 20:62123178-62123200 CCCCCAGGCTGGCGGGGAGGAGG - Intronic
1175903293 20:62368264-62368286 CCGAGGGGGTGGCGGCGGGGTGG + Intergenic
1175917606 20:62434043-62434065 CCAGGAGCCTGGTGTCGGGGAGG + Intergenic
1175940506 20:62535519-62535541 CCAAGAGGGTGGCTGAGGGGTGG + Intergenic
1176062640 20:63178995-63179017 CCGCGGTGCTGGCGGCGGGGCGG + Intergenic
1176247079 20:64102433-64102455 CCTCCCGGCTGGCCGCGGGGCGG + Intergenic
1176378655 21:6100668-6100690 ACAAGAGGCTGGCAGTGGGGTGG - Intergenic
1176454537 21:6897634-6897656 CCTCGAAGCAGGCGGCGCGGAGG - Intergenic
1176649280 21:9530573-9530595 CTACAATGCTGGCGGGGGGGTGG + Intergenic
1176832710 21:13762682-13762704 CCTCGAAGCAGGCGGCGCGGAGG - Intergenic
1178561504 21:33642909-33642931 CCTCGGGGGTGGCGGCGGAGTGG + Intronic
1179744820 21:43437569-43437591 ACAAGAGGCTGGCAGTGGGGTGG + Intergenic
1179797404 21:43793414-43793436 CCACCAGGGTGCCGGCGGGCGGG + Intronic
1179996307 21:44975997-44976019 CCCTGAGCCTGGTGGCGGGGAGG - Intronic
1180090400 21:45531144-45531166 CCACGGGGCAGGGGGCGGGGAGG + Intronic
1180090422 21:45531188-45531210 CCACGGGGCAGGGGGCGGGGAGG + Intronic
1180260084 21:46662602-46662624 CCCCGAGTCTGGGGGCGTGGAGG + Intronic
1182124050 22:27803890-27803912 CCCCGGGGCGGGCGGGGGGGGGG - Intergenic
1182427662 22:30283481-30283503 CCACGAGGCTGGCCTGGGTGAGG - Intergenic
1183211593 22:36454889-36454911 CCACGAGCCAGGAGTCGGGGTGG - Intergenic
1184202700 22:42981468-42981490 CCGGGAGGGAGGCGGCGGGGGGG + Intronic
1185082152 22:48715456-48715478 CGAGGAGGCTGGGGGTGGGGCGG + Intronic
1185156777 22:49197806-49197828 TCGCGAGGCAGGCGGCAGGGAGG - Intergenic
1185259573 22:49854008-49854030 GCTCGCGGCAGGCGGCGGGGCGG - Intronic
1185281715 22:49972534-49972556 ACAGGAGGCTGGGGGCGGTGGGG - Intergenic
952942566 3:38455059-38455081 CCAGGAGGCACGTGGCGGGGTGG + Intronic
953930029 3:47001264-47001286 CCAGGAGGCTGGCGGGTGAGTGG - Exonic
954934468 3:54313742-54313764 CGACAAGGCTGGGGGTGGGGTGG - Intronic
956167569 3:66408033-66408055 CCACGTGGATGGGGGCAGGGAGG - Intronic
960896803 3:122514553-122514575 CCACAAGGCCGGCGGAGGAGAGG - Intronic
963514683 3:146293606-146293628 CAGCGAGGCTGGGGGAGGGGCGG - Intergenic
963514692 3:146293629-146293651 CAGCGAGGCTGGGGGAGGGGCGG - Intergenic
966784226 3:183608956-183608978 CCGGGAGGGAGGCGGCGGGGGGG + Intergenic
967056864 3:185836724-185836746 CAACTAGGATGGCGGCGGGTTGG - Intergenic
967858246 3:194134257-194134279 CCACGTGGCGGGCGCCGGGCCGG - Intergenic
967904130 3:194486892-194486914 CTACGTCGCTGGCGGCGGGGGGG - Intronic
967979036 3:195054502-195054524 CCCCGAGAATGGGGGCGGGGGGG - Intergenic
968230861 3:197003728-197003750 CCAGGAGGCTGCGGGCCGGGAGG - Intronic
968509199 4:987943-987965 CCACCAGGTGGGCGGCGGGCAGG + Exonic
969402883 4:6968657-6968679 CCAGGAGGCTGACCGCCGGGAGG + Intronic
969583950 4:8081301-8081323 CCACGAGGCTGGTGGCCACGGGG - Intronic
972982801 4:44726317-44726339 CCTCGAGGCTGGGGGCGCGTGGG - Intronic
974593686 4:63988808-63988830 CCACATGGCTGGTGGTGGGGGGG - Intergenic
977897416 4:102380455-102380477 CAGCGAGGCTGGGGGAGGGGCGG - Intronic
980542048 4:134208194-134208216 CAGCGAGGCTGGGGGAGGGGCGG + Intergenic
981528846 4:145733326-145733348 CGACGAGGCGGGCGGTGGTGGGG - Intronic
983495935 4:168442412-168442434 CAGCGAGGCTGGGGGAGGGGCGG + Intronic
985933744 5:3079244-3079266 CCAGGAGGCTGCAGGCGGAGTGG - Intergenic
989587557 5:43087325-43087347 CCGGGAGGGAGGCGGCGGGGGGG - Intronic
990383084 5:55234202-55234224 CCCCGAGGCTGGCGGAAGGAAGG - Intergenic
992716371 5:79514420-79514442 CCTAGAGGCTGGCGGCTGGCTGG + Intergenic
992753584 5:79883446-79883468 CCACGAAGCTGGGGGTGGTGGGG + Intergenic
993900210 5:93579761-93579783 CCAGCCGGCTGGGGGCGGGGAGG - Intergenic
1002023848 5:176383664-176383686 CCACTAGGCTGGGGGCTGGTGGG - Intronic
1002186811 5:177458405-177458427 CAATGAGGCTGGTGGCGGCGGGG + Exonic
1002291770 5:178205109-178205131 CCACGCGGCGGGGGGAGGGGCGG + Intronic
1002579126 5:180197016-180197038 GCCCGAGGCTGGCGTCGGTGAGG + Intronic
1002927695 6:1614467-1614489 CCAGGAGGCCGGCGTCGGGGCGG - Intergenic
1004660732 6:17706829-17706851 CGACGACGACGGCGGCGGGGCGG - Exonic
1004978674 6:20997529-20997551 CCACGGGGGTGGCGGGGGGAGGG + Intronic
1005915234 6:30345408-30345430 CCACGGGGCGGGCGGCGGGCGGG + Intronic
1006514760 6:34539602-34539624 CCCCGAGGGTGGAGGAGGGGAGG + Intronic
1006554395 6:34853029-34853051 CCAGGAGGCTGGGGGTGGGGTGG + Intronic
1007614612 6:43172473-43172495 CTACGAGGCTGCCGGGGAGGTGG + Intronic
1011264010 6:85497033-85497055 CCAGGAGGCCAGGGGCGGGGTGG - Intergenic
1012475996 6:99614723-99614745 CCCCGAGGTTGGGGGCGGCGGGG + Exonic
1014586330 6:123202230-123202252 CCACCACGGTGGGGGCGGGGGGG - Intergenic
1015541413 6:134317796-134317818 CCAGGTAGCTGGGGGCGGGGAGG - Exonic
1016386840 6:143537304-143537326 CCGGCAGGCTGGCGGCGGGGTGG + Intronic
1018400408 6:163414914-163414936 TCACGAGGCCGGCGGGCGGGCGG - Exonic
1018743061 6:166744759-166744781 CCACGTCCCTGGCGGCGGTGGGG + Intronic
1018792978 6:167163626-167163648 CCACCAGGCTAGGGGAGGGGAGG + Intronic
1019179471 6:170177413-170177435 CCAAGAGGCAGGCAGCGAGGAGG - Intergenic
1019647383 7:2138324-2138346 TCAGCAGGCTGGCGGTGGGGCGG + Intronic
1020059753 7:5143580-5143602 CCGTGAGGCTGGGGGCGGGGTGG - Intergenic
1020168218 7:5824167-5824189 CCGTGAGGCTGGGGGCGGGGTGG + Intergenic
1020204747 7:6105465-6105487 CCACGCGGGGGGCGGCGGGCGGG - Intronic
1020256040 7:6503676-6503698 CCAAGAGGATGGCTGCGGGCGGG + Exonic
1021840378 7:24717433-24717455 GCACGAGGCTGGCTGCAGTGGGG - Intronic
1023039046 7:36156165-36156187 TGGTGAGGCTGGCGGCGGGGGGG + Intronic
1023287102 7:38631389-38631411 CAGCGGGGCTGGCGGCGGCGCGG + Exonic
1023969494 7:44980510-44980532 CCAAGAGCCTGGGGGTGGGGAGG - Intergenic
1027233033 7:76282896-76282918 CGACGGGGCGGGCGGCGGGGTGG + Intronic
1029384061 7:100232048-100232070 CCACCTGGCAGGGGGCGGGGTGG + Intronic
1031966665 7:128032176-128032198 CCGCGAGGCAGGCGACGGAGGGG - Intronic
1032005984 7:128302271-128302293 ACACGCGGCTGGCTGCGGGCAGG + Exonic
1032840359 7:135708353-135708375 CAAAGAGGCTGGCGAAGGGGAGG + Intronic
1033486776 7:141797895-141797917 ACCAGAGGCTGGGGGCGGGGTGG - Intergenic
1034638768 7:152586247-152586269 CCGGGAGGGAGGCGGCGGGGGGG - Intergenic
1034900876 7:154907186-154907208 CCACAGGGGTGGAGGCGGGGAGG - Intergenic
1034987299 7:155524211-155524233 CCCCGAGGCTAGAGGTGGGGTGG + Intronic
1035212175 7:157336824-157336846 CCAGGAGACTGGGGGCGAGGGGG - Intronic
1035538142 8:407547-407569 CCAGGAGGGTGGGGGCGGGAAGG - Intronic
1035791258 8:2307550-2307572 CAGCGAGGCTGGGGGTGGGGGGG - Intergenic
1035801547 8:2414155-2414177 CAGCGAGGCTGGGGGTGGGGGGG + Intergenic
1036125445 8:6057704-6057726 CCATCAGGCTGGCGCCGGGAAGG + Intergenic
1037705895 8:21314713-21314735 GCAGGAGGCTGGGGGCGGGGAGG + Intergenic
1037876524 8:22551554-22551576 CCGCAGGGCTGGCGTCGGGGAGG - Intronic
1038017711 8:23529277-23529299 CCCCGAGGCTGCCGGCGCGCGGG - Intronic
1038455380 8:27669286-27669308 CCACGAAGCTGTTGGCGGTGCGG - Intronic
1038498943 8:28027280-28027302 CCACGAGCCTGTAGGTGGGGAGG - Intronic
1039053111 8:33512651-33512673 GAACGAGGATGGAGGCGGGGAGG + Exonic
1040928796 8:52713814-52713836 CCACTAGGCTGCCGGAGGTGTGG - Intronic
1041355247 8:56993438-56993460 CGGCGAGCCTGGCGGCGGCGCGG - Exonic
1041709201 8:60877337-60877359 CGAGGCGGATGGCGGCGGGGAGG + Intergenic
1044453906 8:92369765-92369787 CAGCGAGGCTGGGGGAGGGGCGG - Intergenic
1044821537 8:96158981-96159003 GCTCGGGGCTGGGGGCGGGGGGG + Intronic
1044839771 8:96327772-96327794 CCACGGGGCTGGCGGCAAGGAGG - Intronic
1046849052 8:118952210-118952232 CCAGGAGGCTGGCCGCTGGCGGG - Intergenic
1047277032 8:123413889-123413911 ACAAGAGTATGGCGGCGGGGAGG + Intronic
1047292287 8:123541109-123541131 CCGCGACGGGGGCGGCGGGGCGG + Exonic
1049213569 8:141397602-141397624 TCACAAGGCAGGTGGCGGGGCGG + Intronic
1049488108 8:142876874-142876896 CCAAGTTGCTGGCTGCGGGGAGG + Exonic
1049537577 8:143189507-143189529 CCACGGGGGTGGGGGCGGGGAGG - Intergenic
1049621815 8:143601685-143601707 CCAGGAGGCTGGTGTCGGTGAGG + Exonic
1049710895 8:144062889-144062911 CCAGGAGGCAGGCGGAGGTGGGG - Intronic
1051306899 9:15719377-15719399 CTTCAAGGCTGGCGGGGGGGTGG + Intronic
1052858718 9:33423608-33423630 CCGGGAGGGAGGCGGCGGGGGGG + Intergenic
1054927119 9:70600603-70600625 TCAGGAGGCTGGGGGTGGGGTGG + Intronic
1056643158 9:88388248-88388270 TCACCTGGCTGGCGGCAGGGCGG - Intergenic
1057054180 9:91949084-91949106 GTAGGAGGCTGGCGGCGGGAGGG - Intronic
1057799343 9:98180699-98180721 ACAGGAGGCTGGAGGTGGGGAGG - Intronic
1060185576 9:121562101-121562123 CCCCGAGTCTGGCTGCGTGGAGG - Intergenic
1060555318 9:124504833-124504855 GCGCGGGGCTGGCGGCGCGGGGG + Intronic
1060732810 9:126048938-126048960 CCTAGAGGCTGGTGTCGGGGAGG - Intergenic
1060814318 9:126626773-126626795 CCGCGGGGCTGGGGGTGGGGCGG - Intronic
1061316066 9:129796505-129796527 CTAGGAGGCTGGTGGCAGGGAGG + Intergenic
1061383535 9:130275093-130275115 CCCGGATGCTGGCGGCGGTGTGG - Intergenic
1061987118 9:134136229-134136251 ACACAAGGCGGGCAGCGGGGCGG + Intronic
1062120982 9:134833936-134833958 CCTAGAGGCTGGAGGTGGGGAGG + Intronic
1062173386 9:135147746-135147768 CCACATGGCAGGCGGCGGGCAGG + Intergenic
1062209505 9:135356092-135356114 CCCCGAGGCTGGTGTCTGGGTGG - Intergenic
1062389422 9:136327986-136328008 CCGGGGGGCTGGAGGCGGGGTGG + Intronic
1062502026 9:136855751-136855773 CCCCGAGGCTGGGGGCTGGGAGG + Exonic
1062559875 9:137136742-137136764 CCGCGAGGCTGGGGTCAGGGAGG + Intergenic
1062569602 9:137179071-137179093 CCAGGAGGCCGGCGGGCGGGCGG - Intronic
1203627021 Un_KI270750v1:34121-34143 CTACAATGCTGGCGGGGGGGTGG + Intergenic
1187437759 X:19288227-19288249 ACACGAGGGTGGGGGTGGGGAGG - Intergenic
1188078648 X:25808629-25808651 CCATGGGGCTGGGGGAGGGGTGG + Intergenic
1188651115 X:32632717-32632739 CCAGGACGCTGGGTGCGGGGGGG + Intronic
1189207837 X:39257033-39257055 CCAGGTGGCTGGGGGAGGGGTGG - Intergenic
1189322813 X:40096842-40096864 CCGCGAGTCGGGCGGAGGGGGGG - Intronic
1190225128 X:48539509-48539531 CCACGGGGCTGGGGGAGGCGGGG + Exonic
1193123987 X:77851895-77851917 TCAGGGGGCGGGCGGCGGGGCGG - Intronic
1195086108 X:101416157-101416179 GGACGAGGCGGGGGGCGGGGGGG - Intergenic
1195138169 X:101931763-101931785 CCACTATGGCGGCGGCGGGGAGG - Exonic
1197984127 X:132249730-132249752 CAATGAGGCTGGGGGAGGGGCGG - Intergenic
1198440651 X:136659927-136659949 CCGAGAGGGTGGCGGGGGGGGGG - Exonic
1199082242 X:143590187-143590209 CCCTGAGGCGGGGGGCGGGGGGG - Intergenic
1200080851 X:153575634-153575656 CCACGGGGCTGGGGCCGGGGGGG + Intronic
1200318767 X:155162889-155162911 CAGCGAGGCTGGGGGAGGGGTGG - Intergenic
1202055582 Y:20826577-20826599 CAGCGAGGCTGGGGGAGGGGCGG - Intergenic