ID: 1143373336

View in Genome Browser
Species Human (GRCh38)
Location 17:6453904-6453926
Sequence CCAGGGAGTCGGGGTTTTCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 171}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143373324_1143373336 3 Left 1143373324 17:6453878-6453900 CCCCACACAGCAGGTGTGGGCCT 0: 1
1: 0
2: 1
3: 14
4: 228
Right 1143373336 17:6453904-6453926 CCAGGGAGTCGGGGTTTTCCAGG 0: 1
1: 0
2: 1
3: 21
4: 171
1143373320_1143373336 15 Left 1143373320 17:6453866-6453888 CCACGTGGGCAGCCCCACACAGC 0: 1
1: 0
2: 1
3: 26
4: 196
Right 1143373336 17:6453904-6453926 CCAGGGAGTCGGGGTTTTCCAGG 0: 1
1: 0
2: 1
3: 21
4: 171
1143373326_1143373336 1 Left 1143373326 17:6453880-6453902 CCACACAGCAGGTGTGGGCCTGG 0: 1
1: 0
2: 1
3: 45
4: 348
Right 1143373336 17:6453904-6453926 CCAGGGAGTCGGGGTTTTCCAGG 0: 1
1: 0
2: 1
3: 21
4: 171
1143373325_1143373336 2 Left 1143373325 17:6453879-6453901 CCCACACAGCAGGTGTGGGCCTG 0: 1
1: 0
2: 1
3: 30
4: 219
Right 1143373336 17:6453904-6453926 CCAGGGAGTCGGGGTTTTCCAGG 0: 1
1: 0
2: 1
3: 21
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143373336 Original CRISPR CCAGGGAGTCGGGGTTTTCC AGG Exonic