ID: 1143376325

View in Genome Browser
Species Human (GRCh38)
Location 17:6469690-6469712
Sequence GAGGCTGCTGTTTTCACGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143376325 Original CRISPR GAGGCTGCTGTTTTCACGGC AGG (reversed) Intronic
901642821 1:10701705-10701727 CAGGCTGCTGGTTTGAGGGCTGG + Intronic
901813348 1:11779913-11779935 GCGGCTGCTGCAGTCACGGCTGG + Exonic
901869639 1:12130450-12130472 GAGGCAGCTGATTCCAGGGCCGG - Intronic
905263818 1:36737770-36737792 GAGGTTTCTGTTTTCCTGGCTGG - Intergenic
907514916 1:54987742-54987764 GAGCCTGCTGGCTGCACGGCTGG + Intronic
907932565 1:59014289-59014311 GAGGCAGCCCTTTTCACAGCTGG - Intergenic
908872777 1:68633611-68633633 GACGCTTTTGTTTTCACTGCAGG - Intergenic
915651715 1:157316925-157316947 GGGGCTGCTGTTCTCAAGGAGGG - Intergenic
918959096 1:191247925-191247947 GAGCCTGCAGTTTTCCCTGCTGG + Intergenic
920547671 1:206832057-206832079 GTGGGTGCTGTTTTCCCAGCAGG - Intronic
1062936651 10:1395469-1395491 GAGGCTGCGGTCATCAGGGCTGG - Intronic
1065820863 10:29523975-29523997 GACACTGATGTGTTCACGGCAGG + Exonic
1067570625 10:47368633-47368655 GAGGCTGCTGTGGGCAGGGCGGG - Exonic
1070050860 10:72888393-72888415 TAGGCTGATGTTTTCTGGGCTGG - Intergenic
1070589187 10:77789528-77789550 GTGGCTGCTGGTTTTAGGGCTGG - Intergenic
1073151937 10:101317627-101317649 CAGGCTGCTGTTCTCAGCGCTGG - Intergenic
1073461776 10:103669664-103669686 CAGGCTGCTGCTTTCTCTGCTGG + Intronic
1075349147 10:121708567-121708589 GGGGATGCTGCTTTCAAGGCTGG - Intergenic
1084272669 11:68037594-68037616 GAGGCTGGTGTTTTTGCTGCAGG - Intergenic
1085567326 11:77526095-77526117 CTGCCTGCTGTTTTCAAGGCTGG - Intronic
1086520316 11:87661562-87661584 GAGGCTACATTTTTTACGGCAGG - Intergenic
1091748996 12:3010982-3011004 GAGGCTGCTGGTGTCTCTGCAGG + Exonic
1093199270 12:16167578-16167600 GAGGATACTGTTTTCCCAGCAGG - Intergenic
1094190109 12:27689473-27689495 GACCCTGCTGTTTTCCCTGCAGG - Intronic
1095953093 12:47791943-47791965 GTGCCTGCTGTTGTCACCGCAGG + Exonic
1100468806 12:94873073-94873095 GCGGCTGCTGCTTTACCGGCAGG - Intergenic
1101019591 12:100539960-100539982 GAGGCTTGTGTGTTCACAGCAGG + Intronic
1101420770 12:104549117-104549139 GAGGCTCCAGTTTTCACTTCTGG - Intronic
1102678589 12:114674705-114674727 GGGGCTGCCCTTGTCACGGCAGG + Exonic
1103796452 12:123506380-123506402 GAGGCTCCTGTTGTCCCTGCAGG - Intronic
1105029984 12:132875278-132875300 GAGTGTGCTGTTCTCACTGCAGG - Intronic
1105271039 13:18875473-18875495 GTGGCTGCACTATTCACGGCGGG - Intergenic
1114910082 14:27181457-27181479 GATGCTTCTGTTGTCACTGCAGG + Intergenic
1115476595 14:33820597-33820619 GAAGCTCCTGTTTTCACATCAGG + Intergenic
1115978769 14:39026024-39026046 GAAGCTGCTGTTTTCTCTTCTGG - Intergenic
1119676247 14:76557322-76557344 GAGCCTGCTGTTTTCAGGAGCGG + Intergenic
1120401174 14:84033979-84034001 GAGGCTGATATTTTCTCAGCAGG - Intergenic
1121539061 14:94711524-94711546 GAGGCAGCTGTGTTCTGGGCTGG + Intergenic
1122888789 14:104723368-104723390 GAGGCTCCCGTGTTCCCGGCTGG - Intergenic
1124799685 15:32819424-32819446 TATGCTGCTGTTTTTATGGCTGG + Intronic
1127788258 15:62375570-62375592 GAGGCTGCTGTCTTTGGGGCGGG - Intergenic
1129133763 15:73527383-73527405 GATGCTGCAGTTTTCAGGGCAGG - Intronic
1129177080 15:73847959-73847981 GAGGCTGCTGGTGACAGGGCAGG + Intergenic
1129671527 15:77610481-77610503 GAGGCTGCTTTCTTCATGCCTGG - Intergenic
1130041089 15:80405376-80405398 GAGGCTGCTGTGGGCACGGCAGG + Intronic
1132421702 15:101675522-101675544 GAGGCTGCAGTCTTCACAGGAGG - Intronic
1132667493 16:1088917-1088939 GGGGCTGCTGTGGTCACGTCTGG + Intergenic
1132709885 16:1261751-1261773 GGGGCTGCTGGGTTGACGGCAGG - Intergenic
1135669516 16:24363157-24363179 AAGGCTGCTGTTTACAAGTCAGG - Intergenic
1137601514 16:49759537-49759559 GAGGCTGCTGTGGTCCCGCCAGG - Intronic
1137909342 16:52360719-52360741 GAGGCTGCTGCTCTCACCACAGG + Intergenic
1138659600 16:58509416-58509438 GGGGCTCCTGTTTGCAGGGCTGG + Intronic
1139293063 16:65875268-65875290 AAGGCTGGTGTTTTCCCAGCAGG + Intergenic
1140098587 16:71895557-71895579 GTGTCTGCTGCGTTCACGGCAGG + Intronic
1141225259 16:82108949-82108971 CAGGCAGCTTCTTTCACGGCTGG + Intergenic
1141735639 16:85850649-85850671 GAGCATGCTGTTTTCATGGTAGG - Intergenic
1141938080 16:87255242-87255264 GGGGCTGCTGTGGTCACTGCTGG + Intronic
1142340610 16:89519808-89519830 GGGGCTGCTGTCTTCAGGGGCGG + Intronic
1142376837 16:89710921-89710943 GCGGCTGCTCTGCTCACGGCGGG + Exonic
1143376325 17:6469690-6469712 GAGGCTGCTGTTTTCACGGCAGG - Intronic
1143844993 17:9767232-9767254 GTGCCTGGTGTTTTCCCGGCAGG + Intergenic
1143948326 17:10613854-10613876 GAGGCTCCTCTTTCCACGACGGG - Intergenic
1144625018 17:16840116-16840138 GAGGGTGGTGTTTTCAGGGAAGG - Intergenic
1144881412 17:18432605-18432627 GAGGGTGGTGTTTTCAGGGAAGG + Intergenic
1145150821 17:20511781-20511803 GAGGGTGGTGTTTTCAGGGAAGG - Intergenic
1147579172 17:41618813-41618835 GAGGCTGGCGTTTTCAGGGAAGG - Intergenic
1147594083 17:41705578-41705600 TAGGCAGCTGTGTTCACGGTGGG + Intergenic
1149429770 17:56588456-56588478 GAGGCTTCTGTCTCCAGGGCTGG + Intergenic
1152007886 17:77693977-77693999 GAGGATGCTGTCTCCACCGCAGG - Intergenic
1152133479 17:78491016-78491038 GAGGCTGCTGGATTCAGGGAAGG - Intronic
1152540531 17:80972182-80972204 GGGGCTGGTGCTTTCAGGGCTGG - Intergenic
1152926065 17:83088313-83088335 GGGGCTGCTGTTTGCAGGCCAGG + Intronic
1154149766 18:11897089-11897111 GAGGCTGTGGTTTTCACTTCAGG + Exonic
1155532965 18:26786129-26786151 GAAGCTGCTGTTTTGATGGAGGG + Intergenic
1158218782 18:55128707-55128729 AAGGCTGCTCTTTTCCAGGCAGG - Intergenic
1161570407 19:5027392-5027414 GAAGCTGCCGTTTGCATGGCTGG + Intronic
1162679061 19:12324926-12324948 CAGGCTGCTGTCTTCAAGACTGG - Intronic
1162686948 19:12394994-12395016 CAGGCTGCTGTGTTCAAGACTGG - Intronic
1165682794 19:37791724-37791746 GTGTCTGCTGTGTTCATGGCAGG + Intronic
1165993574 19:39829764-39829786 GAGGCTGATGTCTTCAGAGCAGG - Intronic
1166045022 19:40224873-40224895 GAGGCTGCTGCATCCAGGGCTGG - Intronic
1166066854 19:40365173-40365195 GTGGCACCTCTTTTCACGGCAGG - Intronic
1167421903 19:49408972-49408994 GAGGCTGGAGATTTCACGCCTGG + Exonic
925852853 2:8099682-8099704 GAGGCTGTTGCTTTCATGGAGGG - Intergenic
926869559 2:17398868-17398890 GAAGCTGGTGTTTTCAAGGGTGG - Intergenic
928403536 2:30996608-30996630 GAGGCTGCTGGTTTCCCTACAGG + Intronic
930204373 2:48573300-48573322 GATCCTGCTGTTTCCAAGGCTGG - Intronic
931434112 2:62232297-62232319 GAAGCTGCTGTTTTTCTGGCTGG + Intergenic
931551292 2:63449830-63449852 GGGGCTGTGGTTTTCAGGGCAGG - Intronic
933019170 2:77169529-77169551 GAGGATTCTGCTTTCACGGATGG + Intronic
933169833 2:79112993-79113015 GAGGCTTCTGTTCTCACGGGTGG - Intergenic
935558746 2:104539114-104539136 GAGGCTGCTGTTCTCACATGTGG + Intergenic
935734939 2:106098987-106099009 TAGGCTGCTGTGTACAAGGCTGG + Intronic
937215976 2:120313906-120313928 AGGGCTGCTGTTGACACGGCGGG - Intergenic
939120789 2:138113971-138113993 TAGGCTGATGTTTTCTGGGCTGG - Intergenic
941833508 2:169989984-169990006 GAGATTGCTGATTTCAGGGCAGG - Intronic
942840234 2:180351262-180351284 GAGGCTTCTGTATTGATGGCTGG + Intergenic
949060090 2:241951972-241951994 GAGGCTCCTGTTTGAACTGCTGG - Intergenic
1168868541 20:1109334-1109356 GAGGCAGCTGTGATCACTGCTGG + Intergenic
1169810027 20:9600637-9600659 AAGGCTGCTGATTTCTCTGCTGG + Intronic
1170892026 20:20384153-20384175 GAGGCTGCTGTCTGCAAGCCAGG - Intergenic
1171431635 20:25086518-25086540 GAGGCTGCTGTGTTCAGCTCTGG - Intergenic
1173103985 20:40114562-40114584 GAGGCAGGATTTTTCACGGCAGG - Intergenic
1175176326 20:57114658-57114680 GAGAGTGCTGTTTACACAGCAGG - Intergenic
1175413724 20:58787774-58787796 GAGGCTGCTGTTGCCGCGGGTGG - Intergenic
1175777970 20:61664784-61664806 GAGTCTGCTGATTTCTCAGCAGG - Intronic
1176431580 21:6579404-6579426 GAGGCTTCTGTTTCCAAAGCAGG + Intergenic
1176856789 21:13980704-13980726 GTGGCTGCACTATTCACGGCGGG - Intergenic
1176867791 21:14063509-14063531 GTGGCTGCACTATTCACGGCGGG + Intergenic
1179706974 21:43186866-43186888 GAGGCTTCTGTTTCCAAAGCAGG + Intergenic
1180165242 21:46022416-46022438 GAGGCTACTGAGTTCACCGCTGG - Intergenic
1181301797 22:21885498-21885520 GAGGCTGTGGTTTTCACTTCAGG + Intergenic
1183316545 22:37140096-37140118 CAGGATGCTGATTTCAGGGCCGG + Intronic
1183814811 22:40290753-40290775 GGGCCTGCTGTGTTCACTGCTGG + Intronic
1183815171 22:40293741-40293763 GGGCCTGCTGTGTTCACTGCTGG + Intronic
1184099048 22:42332061-42332083 GTGTCTGCTGAGTTCACGGCTGG - Intronic
1184986676 22:48140632-48140654 AACGCAGCTGTTTTCACTGCAGG + Intergenic
950714370 3:14837251-14837273 GAGGCTGCTGTCTCCATGGCTGG + Intronic
950968563 3:17164106-17164128 AAGACTGCTGTTTTCAGAGCTGG + Intronic
955796375 3:62641561-62641583 GAGGCTGCTGATCTAATGGCAGG + Intronic
957046848 3:75382361-75382383 AAGGCTGCTGTCTGCAAGGCAGG + Intergenic
961878915 3:130046429-130046451 AAGGCTGCTGTCTACAAGGCAGG + Intergenic
964633357 3:158835712-158835734 GAGGCTGCTGCTTTGACTGTCGG + Intergenic
966326002 3:178755115-178755137 GAGAGTGCCGTTTCCACGGCAGG + Intronic
967894402 3:194384621-194384643 GAGCCTGCTGTTAGGACGGCTGG + Intergenic
969373825 4:6750207-6750229 GAGGCTGCCGGGTTCAGGGCTGG - Intergenic
969824201 4:9744057-9744079 AAGGCTGCTGTCTGCAAGGCAGG - Intergenic
975362418 4:73486388-73486410 GAAGTTGCTGTTTTCACCTCAGG + Intronic
975491788 4:74997155-74997177 GAGGCTGCTTTTAACACGACAGG - Intronic
976924096 4:90475640-90475662 GATGGTGCTGCTTTCACAGCTGG - Intronic
978175472 4:105726660-105726682 GAAGCTGCTGTTTTTACTCCTGG - Exonic
979656505 4:123200716-123200738 GAGGCTGCTCTTTTGCTGGCTGG + Intronic
980512571 4:133812870-133812892 CAGGCTGCTTTTTTCTCGGGGGG - Intergenic
985104354 4:186486360-186486382 GAGGGTTCCGTTTTCATGGCTGG + Intronic
985580211 5:692242-692264 GAGGCTGCTGTTTTGATAGGTGG - Intronic
987650849 5:20738449-20738471 AAGGCTGCTGATTTCACTGGTGG + Intergenic
988744706 5:34123019-34123041 AAGGCTGCTGATTTCACTGGTGG - Intronic
992213044 5:74499726-74499748 CAAGCTGCTGTTTTCACTCCAGG + Intergenic
993258457 5:85624708-85624730 GAGGCTTTTGTTTTCCCAGCAGG - Intergenic
997225397 5:132205784-132205806 GTGGCTGCAGTTTTCAGGGAGGG - Intronic
997292496 5:132747745-132747767 GCGTCTGCGGTTTTCCCGGCTGG - Exonic
1002023910 5:176383989-176384011 GAACCTGCTGTTTTCAGGGTGGG - Exonic
1012061689 6:94492848-94492870 GTTGCTGCTGTTATCACTGCTGG + Intergenic
1013316849 6:108951529-108951551 GAGGCTGCTGCTTGCACAACCGG - Intronic
1018698022 6:166405743-166405765 GAGCCCGCTGTTTTCAAGGTTGG + Intergenic
1020418331 7:7969858-7969880 GAGGCTGAAGTTTCCACGGAGGG - Intronic
1024624468 7:51193249-51193271 GAGGCTGCTACTTTCATGCCAGG - Intronic
1026846977 7:73703964-73703986 GCGGCTGCTGTGTTAAGGGCCGG - Intronic
1027895656 7:84040546-84040568 CAGGCTTCTGTTTTCACAGAGGG + Intronic
1028511773 7:91633098-91633120 GGTGCTGCTGTTTGCACAGCTGG + Intergenic
1030279044 7:107751262-107751284 GAGGCTGCTGATCTGACGGGAGG + Intronic
1034740701 7:153471004-153471026 GAGGCTGCTGGTGTCCGGGCAGG + Intergenic
1034995024 7:155571665-155571687 GGGGCCGCTGCTTTCAGGGCAGG - Intergenic
1035328146 7:158078250-158078272 GAGGCTGCTGTTATTAATGCGGG - Intronic
1035580589 8:737439-737461 GAGGCCGCTGCTTTCCCGCCGGG + Intronic
1038443218 8:27586020-27586042 GAGGTTGCTGTTCTCCTGGCAGG - Intergenic
1038482189 8:27909494-27909516 GAGGTTGCTGGTGTCACGGTGGG - Intronic
1038896727 8:31791693-31791715 TAGGCTGCTGTATTCACATCTGG + Intronic
1039607186 8:38891102-38891124 AAGGCTGCTCTTATCACCGCAGG + Intergenic
1042444064 8:68863042-68863064 GAGGCTGCAGAGTTCACGGCTGG - Intergenic
1045101169 8:98845965-98845987 GAAGTTGCTGTTGTCACTGCTGG + Intronic
1047184931 8:122624351-122624373 GAGGCAGCTCTTTGCATGGCAGG - Intergenic
1048924531 8:139259661-139259683 GAGGCTGCCTTCTTCACGGAAGG - Intergenic
1049915969 9:318939-318961 GAGGCAGCTGTTCTCACAGGTGG + Intronic
1057171226 9:92964457-92964479 GAGACGGATGTTTTCAAGGCAGG + Intronic
1058562233 9:106242246-106242268 GAGGCTGCAGTATCCACTGCAGG - Intergenic
1059346378 9:113631767-113631789 GAGGCTGAGGTTTTCTCTGCTGG + Intergenic
1059490140 9:114660033-114660055 GAGTCTCCTGTGTTCACTGCTGG + Intergenic
1061003628 9:127916445-127916467 GGGGCTGCTGTCTCCAGGGCTGG + Exonic
1061635432 9:131905429-131905451 GAAGCTGCTGTTTTCTGTGCTGG + Intronic
1061943909 9:133897873-133897895 GAGGCTGCTGTCTCCCTGGCAGG - Intronic
1062046575 9:134427222-134427244 GTGGAAGCTGTTTTCGCGGCTGG + Intronic
1189407042 X:40735092-40735114 GAGGCTGCTGTGTTCTCCGCTGG - Intronic
1195364522 X:104113495-104113517 GAGGCTAATTTTCTCACGGCAGG + Exonic
1197495807 X:127178159-127178181 GATGCTGCTGTTTTCATTCCAGG - Intergenic