ID: 1143377882

View in Genome Browser
Species Human (GRCh38)
Location 17:6478095-6478117
Sequence CACCTGGAAGAGATGCAGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 280}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143377874_1143377882 1 Left 1143377874 17:6478071-6478093 CCCCACACAGTCCCCGATGAGAC 0: 1
1: 0
2: 2
3: 27
4: 292
Right 1143377882 17:6478095-6478117 CACCTGGAAGAGATGCAGCTGGG 0: 1
1: 0
2: 0
3: 21
4: 280
1143377875_1143377882 0 Left 1143377875 17:6478072-6478094 CCCACACAGTCCCCGATGAGACA 0: 1
1: 0
2: 0
3: 14
4: 110
Right 1143377882 17:6478095-6478117 CACCTGGAAGAGATGCAGCTGGG 0: 1
1: 0
2: 0
3: 21
4: 280
1143377872_1143377882 3 Left 1143377872 17:6478069-6478091 CCCCCCACACAGTCCCCGATGAG 0: 1
1: 0
2: 1
3: 15
4: 275
Right 1143377882 17:6478095-6478117 CACCTGGAAGAGATGCAGCTGGG 0: 1
1: 0
2: 0
3: 21
4: 280
1143377873_1143377882 2 Left 1143377873 17:6478070-6478092 CCCCCACACAGTCCCCGATGAGA 0: 1
1: 0
2: 0
3: 12
4: 157
Right 1143377882 17:6478095-6478117 CACCTGGAAGAGATGCAGCTGGG 0: 1
1: 0
2: 0
3: 21
4: 280
1143377876_1143377882 -1 Left 1143377876 17:6478073-6478095 CCACACAGTCCCCGATGAGACAC 0: 1
1: 0
2: 0
3: 16
4: 130
Right 1143377882 17:6478095-6478117 CACCTGGAAGAGATGCAGCTGGG 0: 1
1: 0
2: 0
3: 21
4: 280
1143377878_1143377882 -10 Left 1143377878 17:6478082-6478104 CCCCGATGAGACACACCTGGAAG 0: 1
1: 0
2: 0
3: 5
4: 115
Right 1143377882 17:6478095-6478117 CACCTGGAAGAGATGCAGCTGGG 0: 1
1: 0
2: 0
3: 21
4: 280
1143377871_1143377882 11 Left 1143377871 17:6478061-6478083 CCAGGAGGCCCCCCACACAGTCC 0: 1
1: 0
2: 3
3: 20
4: 254
Right 1143377882 17:6478095-6478117 CACCTGGAAGAGATGCAGCTGGG 0: 1
1: 0
2: 0
3: 21
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143377882 Original CRISPR CACCTGGAAGAGATGCAGCT GGG Exonic
900323937 1:2098433-2098455 CAACTCGAAGAGCTGAAGCTGGG - Intronic
900715532 1:4141269-4141291 AACCTAGAAAAGAGGCAGCTGGG - Intergenic
901000282 1:6145632-6145654 CTCCAGGAAGAGCTGCTGCTGGG + Intronic
901066490 1:6497056-6497078 CCCCAGGAAGAGAGGCAGCTTGG - Exonic
902317478 1:15633328-15633350 CATCTGTAAGAGATGCAGAGAGG - Intronic
902402841 1:16167505-16167527 CACGTGGAGGAGAGGCAGGTGGG + Intergenic
903829825 1:26168150-26168172 CACATGGAAGAGATTCTTCTAGG - Intergenic
903976765 1:27155058-27155080 GACCAGGAGGAGCTGCAGCTGGG - Intronic
905037376 1:34926970-34926992 CAGCTGGAAGAGATGATGTTAGG + Intronic
905875456 1:41429218-41429240 CAGCTGGGAGAGATGAACCTGGG + Intergenic
906280586 1:44550568-44550590 TACCTTGAAGAGATGCAGAAAGG + Intronic
906894660 1:49758062-49758084 CAGCTGGAACTGAAGCAGCTGGG - Intronic
907396167 1:54191540-54191562 TTCCTGGAGGAGATGCAGGTTGG - Intronic
908338135 1:63148208-63148230 CTCCAGCAAGAAATGCAGCTTGG + Intergenic
908434098 1:64088027-64088049 CAACTGGCAGAAATGTAGCTTGG - Intronic
911307655 1:96250592-96250614 CCCGGGGCAGAGATGCAGCTGGG - Intergenic
912945914 1:114083961-114083983 CTCCTGGAAGGGATGAGGCTGGG + Intergenic
914430974 1:147620058-147620080 CAGCTGGCAGAGAAACAGCTGGG + Exonic
914714088 1:150239813-150239835 GACCTGGCAGAGAGGAAGCTGGG - Intergenic
915318553 1:155043346-155043368 CACCAGGAAGAGAAGCAGGCTGG + Exonic
915642399 1:157238956-157238978 CACTTGGAAGAGACGCAAGTGGG + Intergenic
919825413 1:201500029-201500051 CAGCTGGAAGAGATAGACCTGGG + Intronic
920324956 1:205155927-205155949 CAGCTGGAACTGAAGCAGCTGGG - Intronic
920333482 1:205228561-205228583 CACCATGAAGAGGTGCAGATCGG + Exonic
920977510 1:210799939-210799961 CACCTGGAGGGGAAGGAGCTGGG - Intronic
921436596 1:215130351-215130373 CAAATGGAAGAGATGCATTTGGG - Intronic
921818878 1:219594104-219594126 CACTGGGAAGAGATGCCTCTTGG - Intergenic
922472950 1:225887914-225887936 CTCCTGGAAGAGCCGCAGCACGG + Exonic
922480954 1:225939884-225939906 CTCCTGGAAGAGCCGCAGCACGG + Exonic
1063216113 10:3927084-3927106 CACCTGGCAAAGCTGCAGCTGGG + Intergenic
1063988969 10:11539005-11539027 CACGTGGAGGAAATGCAGCGAGG + Intronic
1066451428 10:35533537-35533559 CACCTGGGACAGAGGGAGCTGGG - Intronic
1067264006 10:44721219-44721241 AACCTGGAAGAGCTCCAGGTGGG - Intergenic
1067308029 10:45083845-45083867 CAGCTGGAAGAAGAGCAGCTTGG + Intergenic
1067441900 10:46313196-46313218 CATGAGGAAGACATGCAGCTTGG - Intronic
1067600108 10:47590317-47590339 CACCTGGAAGAGAAGAATCCAGG + Intergenic
1067752853 10:48983373-48983395 CTCCAGGAAGAACTGCAGCTCGG - Intergenic
1068959338 10:62850914-62850936 AACCAGGAAGTGATGCAGCCAGG - Intronic
1069754089 10:70762597-70762619 CACCTGGCAGTGACGCAGCAGGG - Intergenic
1069991163 10:72317083-72317105 AACCTGGAAGTGAGCCAGCTGGG + Intergenic
1070723664 10:78773601-78773623 CTCCAGGAAGAGCTGGAGCTTGG - Intergenic
1070859654 10:79640858-79640880 CAACTGGATTAGTTGCAGCTGGG - Intergenic
1070859687 10:79641348-79641370 CAACTGGATTAGTTGCAGCTGGG + Intergenic
1071651648 10:87398198-87398220 CACCTGGAAGAGAAGAATCCAGG + Intergenic
1071768979 10:88703393-88703415 CACCTGGAATACAAGCAGCTGGG + Intergenic
1072237814 10:93468357-93468379 CACCTGGTAGAATTGCAGCAAGG + Intronic
1074242495 10:111652920-111652942 CACCTGGAAGTTAAGGAGCTGGG - Intergenic
1074616236 10:115071358-115071380 CATGTGCAAGAGATGCAGATTGG - Intergenic
1076007497 10:126959571-126959593 CACCTGGGGAAGATGCAGCCTGG - Intronic
1076904799 10:133356460-133356482 CAGGTGGAAGAGGTGCACCTGGG - Intronic
1077154865 11:1086735-1086757 CACCTGCAAGAGAGGACGCTGGG + Intergenic
1078459098 11:11499730-11499752 CACCAGGAAGAGGTATAGCTAGG - Intronic
1078624306 11:12939979-12940001 CACCTGGAAGAGAAGCAAGACGG - Intronic
1079107037 11:17578353-17578375 CAGCTGGAAGAGAAGAAGATGGG - Exonic
1079308286 11:19343903-19343925 GATCTGGCAGAGATCCAGCTGGG + Intergenic
1081001497 11:37678529-37678551 GTCCTGGAATAGAGGCAGCTTGG + Intergenic
1081712285 11:45225014-45225036 CACCTGGCAGAGCTGCCGATGGG - Exonic
1082192777 11:49267258-49267280 CACTTGGAAGAGATCCAAGTGGG - Intergenic
1083295752 11:61714664-61714686 CACCTGGCAGTGACGCTGCTGGG + Intronic
1083474681 11:62908440-62908462 CCTCTGGAAGTGAGGCAGCTAGG - Intergenic
1083704633 11:64505564-64505586 CACCTCGAAGCAAGGCAGCTGGG + Intergenic
1086673346 11:89573732-89573754 CACTTGGAAGAGATCCAAGTGGG + Intergenic
1088064133 11:105695304-105695326 CACAGGGAAGAGAATCAGCTGGG - Intronic
1088218067 11:107536121-107536143 CACCTGGATTAGTTACAGCTTGG - Intronic
1088461353 11:110086738-110086760 CATGTGGAAGACATGCAGGTTGG - Intergenic
1088712909 11:112524512-112524534 CACCTGGAAGAGATGGTTCGGGG + Intergenic
1088747577 11:112817333-112817355 CACCTGGGAAAGATGCAGGGTGG + Intergenic
1089129271 11:116199419-116199441 GACCTGGCAGGGAAGCAGCTGGG + Intergenic
1089339148 11:117745760-117745782 TACCAGGAAGTGATGCAGCTGGG - Intronic
1089672606 11:120066984-120067006 CAGCTCCAAGAGATGCAGATGGG - Intergenic
1091082187 11:132681408-132681430 GACATGGGAGAGAAGCAGCTTGG + Intronic
1091684273 12:2550456-2550478 GACCTGGGAGAGAAGCAGCCAGG + Intronic
1092425245 12:8370327-8370349 CACCTGCAAGAGAATCATCTAGG - Intergenic
1092939122 12:13391053-13391075 CACATGGAGGAGATGAAGCCAGG - Intergenic
1094475219 12:30835567-30835589 CACTTGGAAGAGATCCAAGTGGG - Intergenic
1097392296 12:59030497-59030519 AAACTCAAAGAGATGCAGCTTGG - Intergenic
1100394346 12:94171657-94171679 CACATGGGAGACATGCAGATAGG + Intronic
1101201343 12:102439690-102439712 AACCTGGAAAAGATCCAGCTAGG + Intronic
1101584298 12:106071059-106071081 CACCTGACAGCAATGCAGCTGGG + Intronic
1102243845 12:111342520-111342542 CAGCTGAAAGTGATGGAGCTGGG - Intronic
1102524105 12:113499026-113499048 CACCTGTTAGAGATGCTGCCTGG - Intergenic
1102617025 12:114163644-114163666 GACCTGGAAGAGGAGGAGCTGGG + Intergenic
1104820501 12:131674661-131674683 GACATGGGAGAGATGCTGCTGGG + Intergenic
1109515808 13:63441290-63441312 CACTTGGAAGAGATCCAGGTGGG - Intergenic
1112947227 13:104944294-104944316 CATCTGTTAGTGATGCAGCTGGG - Intergenic
1114941032 14:27611053-27611075 CATCTTAAAGAGCTGCAGCTGGG + Intergenic
1115365755 14:32555244-32555266 CACTTGCTAGAGATGGAGCTGGG + Intronic
1115545946 14:34464816-34464838 CACCTGGCAGACATGGTGCTAGG - Intergenic
1116276407 14:42839160-42839182 CACTTGGAAGAGATCCAAGTGGG - Intergenic
1116727562 14:48580437-48580459 CACCTGGAAGAGATCCAAGTGGG + Intergenic
1116967849 14:51032610-51032632 CACCTGGAAGTGAGGAAGCCAGG - Intronic
1117022985 14:51590836-51590858 CACCTGGAAGAGATTGCTCTGGG - Intronic
1118478352 14:66140171-66140193 GACCTGGAAGAGACAAAGCTAGG + Intergenic
1119616424 14:76101901-76101923 CACCAGGAAGGGAAGCAGCTAGG - Intergenic
1121466897 14:94121600-94121622 CTCCTGGATGGGCTGCAGCTGGG - Intergenic
1121687977 14:95853647-95853669 CCCATGGAAGGGATGCTGCTGGG - Intergenic
1122626369 14:103087352-103087374 CACCTAGAAGGGAAGCTGCTGGG - Intergenic
1124624466 15:31300150-31300172 CCCCTGGAAGGAGTGCAGCTGGG + Intergenic
1125729212 15:41883343-41883365 CAGCTGGAGGAGCTGCAGGTGGG - Exonic
1126885848 15:53148918-53148940 CACCTGGGAGAGCTACAGCTGGG - Intergenic
1127371424 15:58345378-58345400 CCCTTGGAAGAGATCCAGGTGGG - Intronic
1128800863 15:70496080-70496102 CACCTGTAGAAGCTGCAGCTGGG - Intergenic
1129109370 15:73328764-73328786 CCCCAGGGAGAGATGAAGCTGGG + Intronic
1130083082 15:80751670-80751692 CACCTCAAAGAGATAAAGCTGGG - Intronic
1131225744 15:90623354-90623376 CACTAGGAAGACATGCAGCAGGG - Intronic
1132809657 16:1791453-1791475 TTCCTGGAGGAGCTGCAGCTGGG - Exonic
1133389976 16:5402319-5402341 CACCTGGAAGACATAGTGCTGGG + Intergenic
1133583267 16:7166810-7166832 AACCTGGGAGAGATGCCGCATGG - Intronic
1135121993 16:19774187-19774209 CAGCTGGAAGTGGTGGAGCTGGG - Intronic
1135295472 16:21276077-21276099 CTCCTGGAAGAGATACAGACTGG - Intronic
1137614003 16:49836315-49836337 CACTTGGGAGAGAAGCAGCTTGG - Intronic
1138748290 16:59389279-59389301 CACTTGGAAGAGATCCAAGTGGG + Intergenic
1138881988 16:61027605-61027627 CAACTGGAAGAAAGGGAGCTGGG + Intergenic
1138995816 16:62451870-62451892 CATCTGGAAGAGATCCAAGTGGG + Intergenic
1140140188 16:72248851-72248873 CACATGGAAGAGATACAGTGAGG - Intergenic
1141892594 16:86936545-86936567 CACTTGTAAGAGGTGGAGCTAGG - Intergenic
1142371732 16:89686444-89686466 CACCTGGAAGACCTTCACCTGGG + Exonic
1142742153 17:1937499-1937521 CACCTGGAGGAGCTGGACCTCGG - Exonic
1143377882 17:6478095-6478117 CACCTGGAAGAGATGCAGCTGGG + Exonic
1143538679 17:7557214-7557236 CACCTGGCAGAGGCGGAGCTGGG - Exonic
1144489945 17:15700028-15700050 CACCTGGAAGAGGTGACGCTGGG - Exonic
1144887202 17:18471464-18471486 CGCCTGGAAGTGAAGGAGCTTGG + Intergenic
1144911016 17:18681931-18681953 CGCCTGGAAGAGGTGACGCTGGG + Intronic
1145145014 17:20472831-20472853 CGCCTGGAAGTGAAGGAGCTTGG - Intergenic
1146353923 17:32118537-32118559 CACCTGGAAGTGAAGGAGCTTGG + Intergenic
1147175733 17:38655097-38655119 CACCTGGGGGAGGAGCAGCTGGG + Intergenic
1149339697 17:55672627-55672649 CAGCTGGAACTGAAGCAGCTGGG + Intergenic
1149656302 17:58311142-58311164 CACCTGCAGCAGCTGCAGCTGGG + Exonic
1150282622 17:63938267-63938289 CACCTGGAAGAGAGGGAGTGTGG + Intergenic
1151163266 17:72183582-72183604 CACAGGGAAGAGGTACAGCTGGG - Intergenic
1151824755 17:76518041-76518063 CAGCTGGAAGACATGCAACAAGG - Intergenic
1153075951 18:1161802-1161824 CAATTAGAAGAGATACAGCTGGG - Intergenic
1153148236 18:2057929-2057951 CTCTTGGAAGAGATCCAACTGGG + Intergenic
1153296591 18:3552127-3552149 CACCTGGAAGAGATGAGGGAAGG - Intronic
1157757337 18:50230471-50230493 CAACTGGAAGAGATGCATAGGGG - Intronic
1158670650 18:59470749-59470771 CACCTGGAAGAGATAGTGCAAGG - Intronic
1160395156 18:78565089-78565111 AACCAGGAAGAGAAGCAGCTTGG + Intergenic
1160786147 19:900950-900972 GACCTGGAAGAGAGGCAGGGAGG + Exonic
1161669498 19:5597634-5597656 CAGCTTGAGGAGATGCAGCACGG - Intronic
1162340547 19:10089255-10089277 CAGCTGGAAGTGATACAGCTGGG + Intronic
1162917786 19:13883483-13883505 CACCTGGAAAAGATGGCGCGAGG - Intronic
1163488078 19:17601098-17601120 AGCCAGGAAGAGATGGAGCTGGG - Intergenic
1165060607 19:33203604-33203626 AACCAGGAAGAGGTCCAGCTTGG - Intronic
1165403879 19:35618446-35618468 CACCTGGATGAGATGAACCATGG - Exonic
1167824427 19:51959397-51959419 AACATAGAAAAGATGCAGCTGGG + Intergenic
925217941 2:2113273-2113295 CACATGGAAGTTTTGCAGCTTGG - Intronic
925692757 2:6541789-6541811 CACTTGGAAGAGACCCAACTAGG + Intergenic
926765815 2:16322027-16322049 CACCTGTAAGTGATGGAACTGGG + Intergenic
927478523 2:23432694-23432716 GACCTGCAAGAGAGGCAGCCAGG + Intronic
928320967 2:30282537-30282559 CACCTGGAAGAGGTGTTTCTTGG - Intronic
929267936 2:39940069-39940091 AACCTGTAAGAGCTGCAACTTGG - Intergenic
932276256 2:70454382-70454404 CACCTGTAACATAAGCAGCTTGG - Intronic
932844243 2:75119078-75119100 CTCATGGAACAGATGCAGCAGGG + Intronic
934847520 2:97671808-97671830 CCCCTGGAGGAGGTTCAGCTCGG - Intergenic
937284961 2:120744781-120744803 CTCCTGGATGAGATTCAGGTGGG + Intronic
938035669 2:128032990-128033012 CACCTGGCATAGGTGCTGCTGGG - Intergenic
941806677 2:169717083-169717105 CCCGTGGCAGAGATGCTGCTCGG - Intronic
942228935 2:173841603-173841625 CTCTGGGAAGAGAGGCAGCTTGG - Intergenic
942739972 2:179165206-179165228 GACATTGAAGAGATTCAGCTAGG - Intronic
944316308 2:198289119-198289141 CACCTGCATGAGATGCGGCCAGG + Intronic
945185544 2:207136005-207136027 CACCAGGAAGAGAAGCAATTAGG + Intronic
945712541 2:213316706-213316728 TAGCTGGGAGAGAAGCAGCTGGG - Intronic
946770812 2:223086464-223086486 CACTTTGCAGAGATGGAGCTGGG - Intronic
947821304 2:233072976-233072998 AACCTGGCAGGGCTGCAGCTAGG + Intronic
948841152 2:240649693-240649715 CACATGGAGGAGAAGCAGCTGGG - Intergenic
1169203761 20:3728998-3729020 CACCTGGAGGAAGTTCAGCTGGG + Intergenic
1170848573 20:19982852-19982874 CCCCTGGAGAAGAGGCAGCTGGG - Intronic
1173375235 20:42477005-42477027 CTGCAGGAAGAGATGCAGTTTGG - Intronic
1173669938 20:44791886-44791908 CACAGGGAAGAAATGGAGCTAGG - Intronic
1174414214 20:50356554-50356576 CAGCTGGCAGAGGTGGAGCTGGG + Intergenic
1174489568 20:50883246-50883268 CTCCTGGAAGAAATCCTGCTTGG - Intergenic
1174597598 20:51696454-51696476 AGCCTGGAAGAGAGCCAGCTGGG - Intronic
1174648044 20:52103087-52103109 CTCCTGGGAAAGGTGCAGCTGGG + Intronic
1174820832 20:53725204-53725226 CACCTGGAGGAGATGGAGGGAGG + Intergenic
1175597533 20:60247191-60247213 GTTCTGGAAGAGATGCTGCTGGG + Intergenic
1175852650 20:62102019-62102041 CAGCTGGAAGACAGACAGCTGGG - Intergenic
1177336901 21:19740531-19740553 CACCTTGAAGTGATGAAGCTAGG + Intergenic
1178406669 21:32329860-32329882 AACATGGGATAGATGCAGCTTGG + Intronic
1178886647 21:36490013-36490035 CAGCCGTAAGAGATACAGCTGGG - Intronic
1179314594 21:40231354-40231376 TACCTGGAACAGAAGCTGCTGGG - Intronic
1180799784 22:18626355-18626377 CACCTTGAGAAGCTGCAGCTGGG - Intergenic
1181104296 22:20564450-20564472 CACCTGCTGGAGCTGCAGCTGGG - Exonic
1181221931 22:21368911-21368933 CACCTTGAGAAGCTGCAGCTGGG + Intergenic
1181322296 22:22017631-22017653 CACCTGGAGAAGAAGCAACTGGG - Intergenic
1181617878 22:24067162-24067184 CACCTGCAGAAGAAGCAGCTGGG - Exonic
1181637322 22:24180550-24180572 CACCTTGAGAAGCTGCAGCTGGG + Intergenic
1181772553 22:25136707-25136729 ATCCTGGAGGAGATGGAGCTTGG + Intronic
1182281048 22:29217851-29217873 CACCAGCAGGAGAAGCAGCTTGG - Intronic
1183552469 22:38498670-38498692 CACTTTGGAGAGATGAAGCTGGG - Intronic
1184197573 22:42940640-42940662 CAGCTTGAAGAGAAGCAGCTGGG - Intronic
1184742708 22:46438333-46438355 CACCTGAAACAAAAGCAGCTAGG + Intronic
1184777803 22:46632042-46632064 CACCTGGAGGACATGGTGCTTGG - Intronic
1185051480 22:48556505-48556527 CATCTGGAAGAGAAGCTTCTTGG + Intronic
1185220807 22:49628245-49628267 CTCCAGGATGAGAGGCAGCTGGG + Intronic
949874821 3:8619291-8619313 CACCTGGAAGATTTGAAGCCTGG - Intergenic
949901730 3:8820744-8820766 CCTCTGGCTGAGATGCAGCTTGG + Intronic
950506270 3:13396808-13396830 CACCTAGAAGAGTTCCAGCCTGG + Intronic
953885599 3:46712842-46712864 CACCTGGGGGAGAGGCATCTGGG - Intronic
958869107 3:99536155-99536177 CACCTAGAACATATTCAGCTTGG + Intergenic
962217287 3:133533515-133533537 CACCTGTTAGAGATGAGGCTAGG - Intergenic
962287915 3:134103845-134103867 CACTTTGAAAAGATGGAGCTGGG - Intronic
963475583 3:145799378-145799400 TGCCTGGATGAGATGCAGCGTGG - Intergenic
965299408 3:166990873-166990895 CCCTTGGAAGAGATGCAAGTGGG - Intergenic
966862819 3:184239920-184239942 CTCCTGTAAGAGAAGCTGCTTGG + Exonic
967658937 3:192081693-192081715 CAACAGGTAGGGATGCAGCTAGG + Intergenic
967889808 3:194356990-194357012 CACCTGGAGGACATGCACCAAGG - Intronic
969152391 4:5180560-5180582 CAGCTGGAAGAGATCCATCAGGG - Intronic
971627749 4:28944588-28944610 CACCAAGAAGAGATTCAGGTGGG + Intergenic
972634411 4:40870545-40870567 CACCTAGAGGAGAGACAGCTGGG + Intronic
974981271 4:68960267-68960289 CACCTTCAGGAGCTGCAGCTGGG + Intergenic
975696960 4:77023039-77023061 CACCAGGAGGAGGTGGAGCTGGG + Intronic
977309136 4:95363048-95363070 CAGCTGGCAGAGGTGTAGCTAGG - Intronic
978155739 4:105487958-105487980 TACCTGGAAGAAATGTGGCTGGG - Intergenic
978309227 4:107367623-107367645 TCCGTGGAAGAGATGCAACTTGG + Intergenic
980650752 4:135711935-135711957 CAGCTGGAACTGAAGCAGCTGGG - Intergenic
981690762 4:147506125-147506147 CCCCTGGAAGAGGTGAAGTTGGG + Intronic
982216593 4:153087674-153087696 CAGCAGGAAGAGATGAAGCGGGG + Intergenic
983184163 4:164682165-164682187 CACATGGAAGAGATCCAAGTGGG + Intergenic
984402328 4:179282298-179282320 CCCCAGGAAGGGATGCAGCCCGG + Intergenic
986129104 5:4910558-4910580 CGCCTGGAACTGAAGCAGCTGGG + Intergenic
986632119 5:9783947-9783969 AGCCAGGAAGAGATGCAGCTGGG - Intergenic
986948256 5:13049871-13049893 CACTTAGAAGAGATCCAGGTGGG - Intergenic
988309996 5:29544183-29544205 CACATGGATGAGATGCACCTTGG + Intergenic
988915648 5:35891328-35891350 CACTTGGAAGAGATCCAAGTGGG - Intergenic
989499472 5:42149337-42149359 CAGCTGGAAGTGGAGCAGCTGGG - Intergenic
993726333 5:91371343-91371365 CAGCCGGAAGAGATACAGTTCGG + Exonic
994253342 5:97563242-97563264 AACCTGGTACATATGCAGCTGGG + Intergenic
995429089 5:112054681-112054703 CGGCTGGAACTGATGCAGCTAGG - Intergenic
995442324 5:112205779-112205801 CACCTGCAGGAGAGGCAGCAAGG + Intronic
996274856 5:121652463-121652485 CACCTGGAAGTGTTGCAGCCTGG + Intergenic
998379743 5:141715776-141715798 CTCCTGGAAGAGAAGCTGGTGGG + Intergenic
998817855 5:146031873-146031895 CACATGGAAGGGATGGTGCTGGG - Intronic
1002455141 5:179341941-179341963 CAGCTGGAAAAGACGCAGGTTGG - Intronic
1002848813 6:972777-972799 CACCTGTAAAAGATGAGGCTGGG - Intergenic
1004877659 6:19971858-19971880 CACCTGGAAGACACTGAGCTTGG + Intergenic
1005886525 6:30101789-30101811 CAGCTGGAAGGGTTGAAGCTAGG - Intergenic
1006029226 6:31167132-31167154 CACTTGGAAGAGATCCAAGTGGG - Intronic
1006044458 6:31282969-31282991 CACGTGGAAGAGGTCCAGCAGGG - Intronic
1006609807 6:35287589-35287611 CAAGGGGAAGAGATACAGCTGGG - Intronic
1007123351 6:39401747-39401769 CATGTGGAAGGGATGCAGGTGGG + Intronic
1008925212 6:56885102-56885124 CAGGTGGAAGGGATGCAGCCAGG - Intronic
1009566792 6:65320515-65320537 CACTGGGAAGAGATGCCTCTTGG + Intronic
1013182220 6:107727652-107727674 CAGAGGGAAGAGATGCAGCGAGG - Intronic
1015004122 6:128257245-128257267 CACCTGGGAGATAGGAAGCTGGG + Intronic
1015211902 6:130708046-130708068 CAACTGGAATGGATGCAGCCTGG + Intergenic
1015373269 6:132480296-132480318 CACCTGGGAGACAAGCATCTTGG + Intronic
1015710581 6:136134834-136134856 CACCTACAAGCGATGCAGCAGGG + Intronic
1016181762 6:141155534-141155556 TACCAGGAAGAGATGCTGATGGG + Intergenic
1016720313 6:147288798-147288820 CACTTGAAAGAGATCCAGGTGGG + Intronic
1017523096 6:155219411-155219433 CTCCTGGAAGAGAGGCGGCAAGG + Intronic
1018783684 6:167091860-167091882 AACCTGGGAGAGAAGCAGCAAGG + Intergenic
1019895313 7:3977749-3977771 CTCCTGGAACAGAAGCACCTTGG + Intronic
1021095657 7:16532788-16532810 CAGCTGGAAGAGACAGAGCTGGG - Intronic
1021801530 7:24311592-24311614 GACCTGGAAGGGAGGAAGCTGGG + Intergenic
1023394762 7:39742621-39742643 CACCTGGAAGAGACCCAGGAAGG + Intergenic
1024430699 7:49285096-49285118 CACCTGGAGCAGAAGCTGCTGGG + Intergenic
1025170666 7:56753769-56753791 GAGTTGGAAGAGATGCAGATTGG + Intergenic
1025256268 7:57385658-57385680 CAGCTGGCAGAGGTGGAGCTGGG - Intergenic
1026952375 7:74356253-74356275 CACCTGGAAGATTTCCACCTTGG + Intronic
1028593930 7:92528304-92528326 TACCTGCAGCAGATGCAGCTGGG + Exonic
1030128529 7:106177856-106177878 CACCTGGGAGGGAAGCACCTGGG - Intergenic
1030606343 7:111642738-111642760 CACTTGGAAGAGATCCAGGAGGG - Intergenic
1034039380 7:147861046-147861068 CACCTACAAGAAAAGCAGCTGGG - Intronic
1034966252 7:155393005-155393027 GAACAGGAAGAGATGCAGGTTGG - Intronic
1035158286 7:156932201-156932223 CACCAGGGAGAGACGAAGCTTGG + Intergenic
1035598847 8:882797-882819 CGCCAGGGAGAGATGCCGCTGGG - Intergenic
1036154370 8:6328022-6328044 GACCCGGTACAGATGCAGCTAGG - Intergenic
1036255297 8:7201409-7201431 CACCTGTAAGAGAAGCATCCAGG - Intergenic
1036362192 8:8086087-8086109 CACCTGTAAGAGAAGCATCCAGG + Intergenic
1037639582 8:20730548-20730570 CCCCTGGAAGAGCTGCAGGGTGG - Intergenic
1037646995 8:20801185-20801207 CAGGTGGAAGAGGTGCAGATAGG + Intergenic
1038182142 8:25239461-25239483 AACCAGGAAGAGGTGAAGCTTGG + Intronic
1040671107 8:49691586-49691608 CAGCTGGGAGACTTGCAGCTTGG - Intergenic
1044265919 8:90181008-90181030 CACTTGGAACCGATGCAGATGGG - Intergenic
1047917914 8:129603022-129603044 CAGCTGGAGGTGAAGCAGCTGGG + Intergenic
1047923407 8:129657899-129657921 CAGCTGGAACAGGAGCAGCTGGG + Intergenic
1048128452 8:131663698-131663720 CACTTGGAAGAGATCCAAGTGGG - Intergenic
1048972355 8:139652323-139652345 GACCTGGAAGAGAATCTGCTTGG - Intronic
1049256986 8:141619421-141619443 CTCCTGTATGAGAAGCAGCTGGG - Intergenic
1049315462 8:141964651-141964673 CAGCTGGGAGAGATGAGGCTGGG + Intergenic
1049469692 8:142769796-142769818 CACCAGGAGAACATGCAGCTCGG - Intronic
1055848314 9:80594337-80594359 CAGCTGGAGGTGAAGCAGCTGGG - Intergenic
1055932161 9:81570536-81570558 CATCTGGAAGAGAGGCTGCCTGG - Intergenic
1056854072 9:90109875-90109897 CACCTAGAGGAGAGGGAGCTGGG - Intergenic
1060231977 9:121832002-121832024 CACATGGCAGAGAGGCAGATTGG + Intronic
1061615765 9:131777894-131777916 CAGCTGGAAAAGAGGCAGATGGG - Intergenic
1062100167 9:134723839-134723861 CACCTGGCAGAGCTGCTGCCTGG + Intronic
1062510392 9:136902215-136902237 TCCTTGAAAGAGATGCAGCTTGG + Intronic
1062537872 9:137028714-137028736 CACCTGGAAGGGAGGCAGGGCGG + Intronic
1190332218 X:49242973-49242995 CACCTGGAGGTGCTGCAGCTTGG - Exonic
1190700156 X:52981732-52981754 CACCTGACAGAGCTGCAACTAGG - Intronic
1193251961 X:79301561-79301583 CACTTGGAAGAGATCCAAGTGGG + Intergenic
1194648072 X:96482690-96482712 CACTTGGAAGAGACCCAGGTGGG + Intergenic
1195802328 X:108726836-108726858 CACTTGGCACAGAAGCAGCTGGG - Intronic
1197075209 X:122344753-122344775 CACTTGGAAGAGATCCAAGTGGG - Intergenic
1199009336 X:142740387-142740409 CACGTGGAAGAGACCCAGGTGGG - Intergenic
1199217520 X:145277337-145277359 CACTTGGAAGAGATCCAGTGAGG - Intergenic
1199615706 X:149653118-149653140 TCTCTGCAAGAGATGCAGCTGGG - Intergenic
1199814376 X:151384937-151384959 CAGCTGGCACAGAGGCAGCTAGG - Intergenic
1200926599 Y:8660222-8660244 CACCTGGAAGAGAGGAACTTGGG - Intergenic
1201853693 Y:18517239-18517261 CACTTGGAAGAGATCCAAGTGGG - Intergenic
1201879628 Y:18803145-18803167 CACTTGGAAGAGATCCAAGTGGG + Intronic