ID: 1143381787

View in Genome Browser
Species Human (GRCh38)
Location 17:6501244-6501266
Sequence GGGGTGTCACCCCATTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4890
Summary {0: 1, 1: 0, 2: 8, 3: 289, 4: 4592}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143381787_1143381791 22 Left 1143381787 17:6501244-6501266 CCTGGGGAATGGGGTGACACCCC 0: 1
1: 0
2: 8
3: 289
4: 4592
Right 1143381791 17:6501289-6501311 TTATAATGTTTTGACATCTCTGG 0: 1
1: 2
2: 9
3: 71
4: 349
1143381787_1143381793 24 Left 1143381787 17:6501244-6501266 CCTGGGGAATGGGGTGACACCCC 0: 1
1: 0
2: 8
3: 289
4: 4592
Right 1143381793 17:6501291-6501313 ATAATGTTTTGACATCTCTGGGG 0: 1
1: 2
2: 4
3: 40
4: 354
1143381787_1143381792 23 Left 1143381787 17:6501244-6501266 CCTGGGGAATGGGGTGACACCCC 0: 1
1: 0
2: 8
3: 289
4: 4592
Right 1143381792 17:6501290-6501312 TATAATGTTTTGACATCTCTGGG 0: 1
1: 2
2: 6
3: 37
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143381787 Original CRISPR GGGGTGTCACCCCATTCCCC AGG (reversed) Intronic
Too many off-targets to display for this crispr