ID: 1143381791

View in Genome Browser
Species Human (GRCh38)
Location 17:6501289-6501311
Sequence TTATAATGTTTTGACATCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 432
Summary {0: 1, 1: 2, 2: 9, 3: 71, 4: 349}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143381789_1143381791 2 Left 1143381789 17:6501264-6501286 CCCTATATTCATCATGCTTGTTA 0: 1
1: 0
2: 1
3: 9
4: 240
Right 1143381791 17:6501289-6501311 TTATAATGTTTTGACATCTCTGG 0: 1
1: 2
2: 9
3: 71
4: 349
1143381787_1143381791 22 Left 1143381787 17:6501244-6501266 CCTGGGGAATGGGGTGACACCCC 0: 1
1: 0
2: 8
3: 289
4: 4592
Right 1143381791 17:6501289-6501311 TTATAATGTTTTGACATCTCTGG 0: 1
1: 2
2: 9
3: 71
4: 349
1143381790_1143381791 1 Left 1143381790 17:6501265-6501287 CCTATATTCATCATGCTTGTTAT 0: 1
1: 0
2: 1
3: 29
4: 272
Right 1143381791 17:6501289-6501311 TTATAATGTTTTGACATCTCTGG 0: 1
1: 2
2: 9
3: 71
4: 349
1143381788_1143381791 3 Left 1143381788 17:6501263-6501285 CCCCTATATTCATCATGCTTGTT 0: 1
1: 0
2: 2
3: 38
4: 222
Right 1143381791 17:6501289-6501311 TTATAATGTTTTGACATCTCTGG 0: 1
1: 2
2: 9
3: 71
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143381791 Original CRISPR TTATAATGTTTTGACATCTC TGG Intronic
900864364 1:5257319-5257341 TTCTGATCTTTTGACATCTTGGG + Intergenic
901136021 1:6996126-6996148 TTCTGATGTTTTGACGTCTTGGG - Intronic
903471316 1:23589371-23589393 TTACAATGCTTTGACATCTGGGG - Intronic
904633883 1:31864577-31864599 TTATGATGCTTTGACATCCTGGG - Intergenic
904995074 1:34625452-34625474 TTATAATGTTTTGACATCTTTGG + Intergenic
905376963 1:37528726-37528748 TTTTAACCTTTTGACATCTTTGG + Intergenic
907800366 1:57759045-57759067 CTATTATGTTCAGACATCTCCGG + Intronic
909149063 1:71977396-71977418 TTATAATCTTTTGAAATCCAAGG - Intronic
909292793 1:73905144-73905166 TAATAATATTTTGTCTTCTCTGG - Intergenic
909438448 1:75671367-75671389 TTATGATGTTTTGACATCTGAGG - Intergenic
910139845 1:84015274-84015296 ATTTGATGTTTTGACATCTGGGG + Intergenic
910410238 1:86935363-86935385 TTATGATGTTTGGACTTCTCTGG + Intronic
910671564 1:89778590-89778612 TTAAAATATTTTTAAATCTCTGG + Intronic
910838560 1:91539597-91539619 TTTTAATGCTTTGACATCTGGGG - Intergenic
911003596 1:93194532-93194554 ATATAACCTTTTGAAATCTCAGG + Intronic
911218934 1:95226590-95226612 ATATAAAGTTTTGACATTACTGG - Intronic
913348950 1:117836715-117836737 ATATATAGTTTTGATATCTCTGG + Intergenic
913721093 1:121596228-121596250 TTAGATTGTTTTGAAATCTTGGG + Intergenic
914994046 1:152524888-152524910 TTCTAAGGTTTTGGAATCTCAGG - Intronic
916306729 1:163343805-163343827 TTATAATTCTTTAACTTCTCTGG - Exonic
916673465 1:167045906-167045928 TTATAATCTCTTGAAATTTCTGG + Intergenic
916728732 1:167547345-167547367 GTATAATGTTTTTCCATGTCTGG - Intronic
916898966 1:169200429-169200451 TTCTGATGTTTTAACATCTGGGG + Intronic
916977652 1:170099064-170099086 TTATAATGCTTTGACATATTGGG + Intergenic
917956184 1:180101403-180101425 TTCTAATGTTTTTACATTTTAGG + Intronic
919501081 1:198339113-198339135 CTCTGATGTTTTGACATCTGGGG + Intergenic
920785665 1:209038651-209038673 TTCTTATGCTTTGACATCTTGGG - Intergenic
922188990 1:223300394-223300416 TTATAAGGTCTTGACACTTCTGG + Intronic
922843706 1:228665874-228665896 TTTTGATGCTTTGACATCTTGGG - Intergenic
923226608 1:231943643-231943665 TTATGATGCTTTGACATCTTGGG - Intronic
923273026 1:232374226-232374248 TTTTGATGCTTTGACATCTGGGG - Intergenic
923405212 1:233652883-233652905 TTCTGATGCTTTGACATCTTGGG + Intronic
1063111040 10:3037606-3037628 TTGTGATGCTTTGACATCTTGGG - Intergenic
1063370515 10:5518896-5518918 TGAAAAAGTTTTGACCTCTCAGG - Intergenic
1063535320 10:6877099-6877121 TTATGATGCTTTGACATCTCGGG - Intergenic
1063547307 10:6993661-6993683 TTTTGATGCTTTGACATCTTGGG - Intergenic
1064296602 10:14084505-14084527 ATGTGATGCTTTGACATCTCAGG + Intronic
1065226272 10:23546715-23546737 TTCTAATTTTCTGACTTCTCTGG + Intergenic
1065571962 10:27080445-27080467 TTTTAATGTTTTAATATTTCTGG - Intronic
1066486673 10:35852310-35852332 TTATGATGTTTTGACCTCTTGGG - Intergenic
1067169501 10:43895110-43895132 TAATTATGCTTTGACATTTCTGG - Intergenic
1067307663 10:45079922-45079944 TTATGATGTTTTGACCTCTTGGG - Intergenic
1067739946 10:48887861-48887883 TTCAAATGTTTTGACATAACAGG - Intronic
1067846008 10:49721785-49721807 TTCTGATGCTTTTACATCTCTGG - Intergenic
1068301881 10:55153899-55153921 TTATAAGGATTTGACAACTCTGG - Intronic
1068535563 10:58237341-58237363 TTATAATGTTATACCATCCCTGG - Intronic
1069211573 10:65767858-65767880 TTATAATGTTATGACTTATTAGG - Intergenic
1070974039 10:80590447-80590469 TTCTGATTTTTTGACATCTGAGG - Intronic
1071322926 10:84482651-84482673 TTCTAATATTTTGGCTTCTCTGG - Intronic
1071492821 10:86147681-86147703 TTTTGATGCTTTGACATCTGGGG + Intronic
1071764208 10:88643848-88643870 TCATATTGTTTTGACATGTTTGG - Intergenic
1072179224 10:92964253-92964275 TTATAATTTATTGGCTTCTCTGG + Intronic
1072309988 10:94145551-94145573 TTAAAATGTTCTGGCTTCTCTGG + Intronic
1073348955 10:102805600-102805622 TTTTAAAGTTTGGCCATCTCTGG + Intronic
1073851127 10:107619412-107619434 TTCTAATGTTTTGACAGCTGGGG - Intergenic
1073930393 10:108567669-108567691 TTCTAATGCTTTCACATCTGAGG + Intergenic
1075552020 10:123399906-123399928 TTATGATGCTTTGACATCTTGGG + Intergenic
1075609880 10:123844156-123844178 GTATAATTTTGTAACATCTCTGG - Intronic
1077768401 11:5187535-5187557 TTATAATGTTTTTAAATCTGGGG + Intergenic
1079733317 11:23962679-23962701 TGATTATGTTGTGATATCTCTGG - Intergenic
1079740703 11:24056088-24056110 ATATAATGTTTTAAGATCACAGG + Intergenic
1080920510 11:36704446-36704468 TTATAATTGTTTGAAATCACTGG + Intergenic
1081109611 11:39118696-39118718 ATATAATGTTTTGCCATCAGGGG + Intergenic
1081882356 11:46464607-46464629 TTATGATGCTTTGACATCTTAGG + Intronic
1082646754 11:55735596-55735618 TTCTGATGCTTTGACATCTTGGG - Intergenic
1082753979 11:57053770-57053792 TTATAATGTATTGACATCTCTGG - Intergenic
1084752539 11:71213820-71213842 TTAGGACGTTTTGACATCTAGGG + Intronic
1088846615 11:113673682-113673704 TTTTGATGTTTTGACATCTGGGG - Intergenic
1088878411 11:113954724-113954746 TTCTGATGCTTTGACATCTGGGG - Intergenic
1089036576 11:115400271-115400293 GTATAATATTTTGAAATATCTGG - Intronic
1089179195 11:116569276-116569298 TTGTAATGTATGGACAACTCAGG - Intergenic
1090405121 11:126471813-126471835 TTATGATGCTTTGACATCTGGGG - Intronic
1093311629 12:17594490-17594512 TTATAATGTTTTCCAATCTCAGG - Intergenic
1094242069 12:28239892-28239914 TTATCTTGTTTTGACAAATCTGG + Intronic
1094342281 12:29426115-29426137 TTGTAATCATTTGACACCTCTGG + Intronic
1095517434 12:43021796-43021818 TTATGATGCTCTGACATCTTGGG - Intergenic
1095787395 12:46124679-46124701 TTGTTTTGTTTTGACATTTCTGG - Intergenic
1096966191 12:55629906-55629928 TTCTGATGTTTTGACATCTGGGG - Intergenic
1097434909 12:59544441-59544463 TAATATTGTTTTGATATCTAGGG + Intergenic
1098400951 12:70074923-70074945 TTATGATACTTTGACATCTTGGG - Intergenic
1100221384 12:92508054-92508076 TCATGATGCTTTGACATCTTGGG + Intergenic
1102895448 12:116594830-116594852 TTCTGATGCTTTGACATCTTGGG - Intergenic
1103287423 12:119814184-119814206 TTACATATTTTTGACATCTCTGG + Intronic
1105754284 13:23450971-23450993 TTATAATGCTTTGACACGTTGGG + Intergenic
1106555961 13:30808770-30808792 TTTTGATGCTTTGACATCTTGGG + Intergenic
1106666120 13:31852468-31852490 TTCTGATGTTTTGACCTCTTGGG - Intergenic
1107101762 13:36600499-36600521 TTCTGATGCTTTGACATCTGGGG - Intergenic
1107227847 13:38072485-38072507 TTTTAATGTTTTCACATATTAGG + Intergenic
1107332692 13:39319025-39319047 TTATAAAGTTTTGAAATCTGGGG - Intergenic
1107654955 13:42582544-42582566 TTTTAACGTTTTGATATCTCTGG - Intronic
1107741057 13:43450855-43450877 TTACAGTGCTTTGACATCTTGGG - Intronic
1107895869 13:44962577-44962599 TTATGATGTTATGACATTACTGG - Intronic
1107981471 13:45738024-45738046 TTCTGATGCTTTGACATCTGGGG - Intergenic
1108707630 13:53004106-53004128 CTATAAAGTTTTGAGATCTGTGG + Intergenic
1108746567 13:53401398-53401420 TTATTATTTTTTGACAACTTGGG + Intergenic
1109300235 13:60583634-60583656 ATCTGATGTTTTGACATCTGGGG + Intergenic
1109689591 13:65868218-65868240 TTATAATGCTGTGTCATCTAGGG + Intergenic
1109796015 13:67314221-67314243 TAATTATGCTTGGACATCTCTGG - Intergenic
1110672711 13:78200279-78200301 TTAAATTATTTTGTCATCTCTGG + Intergenic
1111058364 13:82979881-82979903 TTATGATGCTTTGACATCTCAGG + Intergenic
1111710869 13:91812897-91812919 TAAAAATGTCTTGACATCTTTGG + Intronic
1112107357 13:96255361-96255383 TGATAATGTTTTCACTTCTGTGG - Intronic
1112595495 13:100803667-100803689 TTTTGAAGTTTTGACATCTTGGG + Intergenic
1113128598 13:107008850-107008872 TCATAATTTTATGACATCTCTGG + Intergenic
1113220422 13:108095216-108095238 TAAAAATGTTTTGAGATCTGTGG + Intergenic
1114497771 14:23145583-23145605 TTTTCATGTTTTTAAATCTCAGG + Intronic
1114540611 14:23454823-23454845 TTATGAGGTTTTGACATCTTAGG - Intergenic
1114794468 14:25697013-25697035 TTGACATGTTTTGTCATCTCTGG + Intergenic
1114962136 14:27905786-27905808 TTATAATGTATTGATATTTGTGG + Intergenic
1115287988 14:31738639-31738661 ACAAAAGGTTTTGACATCTCTGG + Intronic
1115759172 14:36560665-36560687 TTATGATGCTTTGACAACTTGGG + Intergenic
1116118585 14:40692406-40692428 TTCTAATGTTTTTATATATCTGG + Intergenic
1116215039 14:42005145-42005167 TTTTAATCTTTTGAACTCTCAGG - Intergenic
1116535934 14:46030046-46030068 TTAGATTGTTTTCACATCTTAGG + Intergenic
1118094077 14:62516913-62516935 GTATAATATTTTTAAATCTCTGG + Intergenic
1118655100 14:67938876-67938898 TTATACTGATTTGCCATCTAGGG + Intronic
1118917207 14:70117615-70117637 TTCTGATGCTTTGACATCTGGGG + Intronic
1119339931 14:73868456-73868478 TTAGGATGTTTTGACATCTTAGG + Intronic
1120041654 14:79760349-79760371 TTATTATATTTTTAAATCTCAGG - Intronic
1120313028 14:82855341-82855363 CTTTAATGTTAGGACATCTCTGG + Intergenic
1123663268 15:22585216-22585238 TTATAATTTTTCAACATTTCAGG + Intergenic
1123686348 15:22800358-22800380 TTTTAATGTTCTCACATGTCTGG + Intronic
1123773010 15:23548090-23548112 TTCTGATGCTTTGACATCTGGGG + Intergenic
1124259367 15:28174643-28174665 TTATAATTTTTCAACATTTCAGG + Intronic
1124317097 15:28679654-28679676 TTATAATTTTTCAACATTTCAGG + Intergenic
1124386206 15:29210015-29210037 TTAAGATGCTTTGACATCTTGGG + Intronic
1124504968 15:30264743-30264765 TCATAGTTTTTTGGCATCTCAGG - Intergenic
1124566348 15:30817831-30817853 TTATAATTTTTCAACATTTCAGG - Intergenic
1124663829 15:31574681-31574703 TTATGACGCTTTGACATCTTGGG + Intronic
1124725518 15:32152826-32152848 TTCTGATGTGTTGACATCTGGGG - Intronic
1124738584 15:32273892-32273914 TCATAGTTTTTTGGCATCTCAGG + Intergenic
1125050278 15:35289765-35289787 TTATTTTGTTCTGACATTTCAGG - Intronic
1125231307 15:37459886-37459908 ATATACTGTTTTGAGATCTAGGG + Intergenic
1126402490 15:48286950-48286972 TGATATTGTTTTTACATCCCTGG - Intronic
1126749787 15:51864949-51864971 TTATGATGCTTTGACATCTTGGG - Intronic
1126999734 15:54488012-54488034 TTATAATGTTGGGATATCTTTGG - Intronic
1127027279 15:54820823-54820845 TTTAAATGTTTAGACATCTAGGG - Intergenic
1128494862 15:68191558-68191580 TTGTCATGCTTTGAAATCTCTGG - Exonic
1129045824 15:72733138-72733160 TTCTGATGTTTTGACATCTGGGG - Intronic
1129998390 15:80026307-80026329 TTCTGATGCTTTGACATCTTGGG - Intergenic
1131257115 15:90870287-90870309 TTATCATGATTTAACCTCTCTGG + Intronic
1131436378 15:92425978-92426000 TTCCAATGCTTTGACATCTGGGG - Intronic
1132075070 15:98813142-98813164 TTCTGATGCTTTGACATCTTGGG + Intronic
1134214327 16:12305115-12305137 TTCTAATGATTTGAAATCTGTGG + Intronic
1135087707 16:19488208-19488230 TTCTGATGTTTTGACATCTGGGG - Intronic
1135797245 16:25457318-25457340 TTCTGATGCTTTGACAGCTCAGG - Intergenic
1136472341 16:30489545-30489567 TTCTGATGCTTTGACATCTTGGG + Intronic
1137450310 16:48567767-48567789 ATATGATGTTTTGACATCTTGGG + Intronic
1137947054 16:52743593-52743615 TTATAATGTTTTGAAAAGTTTGG - Intergenic
1138641491 16:58391508-58391530 TTATGATGCTTTGACATCTTGGG - Intronic
1139107684 16:63847816-63847838 ATATAATATTTTAGCATCTCAGG - Intergenic
1139407174 16:66728371-66728393 TTAAAATTTTTTGGCATCTGTGG - Intronic
1140348132 16:74234620-74234642 TTATATTGTTTTTCCATCTTTGG - Intergenic
1143063879 17:4227706-4227728 TTATAAAGTATTCACATCTTTGG - Intronic
1143381791 17:6501289-6501311 TTATAATGTTTTGACATCTCTGG + Intronic
1143832941 17:9666838-9666860 TTTTGTTGTTTTGAAATCTCAGG - Intronic
1147286045 17:39402792-39402814 ATATTATGTTTTAACAACTCTGG + Intergenic
1147474106 17:40693720-40693742 TTGTAATGCTTTTACATCACAGG + Intergenic
1148462853 17:47848116-47848138 TCATAATGGTGTGACATGTCCGG + Exonic
1152035053 17:77867308-77867330 TTCTGATGCTTTGACATCTTGGG + Intergenic
1152277441 17:79366517-79366539 TCATGATGTTTTGATTTCTCAGG - Intronic
1153093529 18:1374821-1374843 TTGTTATGTTTTGCCATCTTGGG - Intergenic
1154418674 18:14203320-14203342 TTATTATGTTTTAAGTTCTCGGG + Intergenic
1154937068 18:21071735-21071757 TTTTAATGTTTTGACCTGTCTGG - Intronic
1155233092 18:23793364-23793386 TTCTGATGCTTTGACATCTTGGG - Intronic
1156734149 18:40232205-40232227 TTATAATTTTTTTCCATCACTGG - Intergenic
1157098444 18:44708438-44708460 TAAAAATGTTTTTAAATCTCAGG - Intronic
1157416193 18:47505136-47505158 TTCTGATGCTTTGACATCTGAGG - Intergenic
1158446909 18:57529740-57529762 TTAGGATGCTTTGACATCTTGGG - Intergenic
1159480974 18:68990663-68990685 TTATAAAGCTTTAACATCTGTGG - Intronic
1162163051 19:8732969-8732991 TTATAATATATTGATATTTCTGG - Intergenic
1163961474 19:20699131-20699153 TTATAATTTTCTTACATCTAAGG - Intronic
1164813672 19:31177750-31177772 ATATAATAACTTGACATCTCAGG + Intergenic
1164875239 19:31680272-31680294 TTCTCACGTTTTGGCATCTCTGG - Intergenic
1164883405 19:31756336-31756358 TTTTACTGTTTTGACATTTAAGG - Intergenic
1166010167 19:39935642-39935664 TGAGAATTTTTTTACATCTCTGG - Intergenic
1167728675 19:51236601-51236623 TTCTGATGTTTTGACATCTGGGG - Intronic
927752729 2:25684353-25684375 TTATAATGTTTTGATTTTTGGGG + Intergenic
929480804 2:42305935-42305957 TTGGAATGTTTTCACATTTCAGG - Intronic
930232456 2:48857022-48857044 TTATAATGGTTTCACATCTTGGG - Intergenic
930679274 2:54239165-54239187 TAATAATGTTTTTACCTCACTGG + Intronic
930900681 2:56504392-56504414 TTTTAGTGTTGTGAGATCTCTGG - Intergenic
930922341 2:56771704-56771726 TAAAAATGTTTTTAAATCTCTGG + Intergenic
931934261 2:67178436-67178458 TTATAATGATTTCACAGCACAGG - Intergenic
933465953 2:82651954-82651976 TTTCAATATTTTTACATCTCAGG + Intergenic
933503015 2:83140334-83140356 CTAGAATAATTTGACATCTCTGG + Intergenic
933572963 2:84035419-84035441 TTATAATATGTGGACATCTAGGG + Intergenic
933650366 2:84845394-84845416 TTATAATGATTTAAGATATCAGG + Intronic
933797783 2:85934554-85934576 TTTTAACCTTTTGACATCTTTGG + Intergenic
934532223 2:95099423-95099445 TGATAATGTTTGGACATATTGGG - Intronic
935132860 2:100274474-100274496 GTATAATGTTTTCACATCTTGGG + Exonic
935133612 2:100279572-100279594 TTATGATATTTTGACATCTCAGG + Exonic
935162908 2:100544594-100544616 TTCTGGTGATTTGACATCTCAGG + Intergenic
935212999 2:100954341-100954363 TTTTGATGCTTTGACATCTGGGG - Intronic
935529048 2:104210471-104210493 TTATTATATTTTTAAATCTCAGG + Intergenic
935854501 2:107259450-107259472 TTATGATGTTTTGATATCTTGGG - Intergenic
936170595 2:110168887-110168909 TTTGAATGTTTTAATATCTCTGG + Intronic
936614239 2:114032658-114032680 TTATGATGCTTTGATATCTTGGG + Intergenic
936713288 2:115158219-115158241 TTATAGTGTTTTGGTATCTGTGG - Intronic
937300244 2:120834596-120834618 TTCTAATGTTCTCACATCTGGGG - Intronic
937492977 2:122388899-122388921 TTCTGATGCTTTGACATCTGGGG - Intergenic
937887393 2:126909253-126909275 TTCTGATGTTTTGATATCTGGGG + Intergenic
938716001 2:134022447-134022469 TCATATAGTTTTGACATGTCAGG + Intergenic
939231723 2:139435089-139435111 TTAAACAGTTTTGACATCTTTGG - Intergenic
940176280 2:150881008-150881030 TTATGATGCTTTGATATCTGGGG + Intergenic
940670852 2:156666229-156666251 TTATGATGCTTTGACATCTTGGG + Intergenic
941082773 2:161081052-161081074 TTATAATGCTTTAACATGTAGGG + Intergenic
941132079 2:161663785-161663807 TTATATTGTTTCAACATCTTTGG - Intronic
941161453 2:162039986-162040008 TTATGATCTTTTAACATCTGTGG - Intronic
941200063 2:162497043-162497065 TTAAAATTATTTGTCATCTCAGG - Intronic
941362096 2:164563781-164563803 TTAAAATGTTTTGTCATTTATGG - Intronic
941764630 2:169283647-169283669 TTATAATTTTTTGACATCAGAGG - Intronic
942427393 2:175874370-175874392 ATATAATCATTTGACTTCTCTGG + Intergenic
943133441 2:183885844-183885866 TTCTGATGTTTGGACATGTCCGG - Intergenic
943250993 2:185521425-185521447 TTATAGAGATTTGAGATCTCAGG - Intergenic
943533813 2:189121818-189121840 TTATTGTGTTTTGACATTTTAGG + Intronic
944564474 2:200973899-200973921 TTAAAATATTTTTTCATCTCTGG + Exonic
945185920 2:207139525-207139547 TTAGAATGTTTTGAGATCCTTGG - Intronic
945213655 2:207410669-207410691 TTATAGTGTTTTAAAATATCTGG - Intergenic
945420217 2:209626566-209626588 CTTTAGGGTTTTGACATCTCTGG - Intronic
945667869 2:212764529-212764551 TTATAATATTTTAATATCTCTGG - Intergenic
947355072 2:229284128-229284150 TTGAAATATTTTGACAACTCAGG - Intergenic
947951173 2:234148608-234148630 TTATATTGTTTTCACTTCTCAGG - Intergenic
947974567 2:234354456-234354478 TGATAATGTTTGGAAAACTCTGG - Intergenic
1169192487 20:3667060-3667082 TTATGATGGTTTAACATCTCGGG + Intergenic
1169479786 20:5969175-5969197 TGATAATTTTTTGACAACTGTGG + Intronic
1173759238 20:45545330-45545352 TTATAATTTTTTGAGCTCCCAGG - Intronic
1173817549 20:45999351-45999373 TTATGATGCTTTGACATCCAGGG - Intergenic
1176282916 20:64325160-64325182 TTACCATGTTTTCACATCTAAGG + Intergenic
1177597381 21:23262969-23262991 TTGTAATTTTTTGACTACTCTGG + Intergenic
1178192115 21:30295745-30295767 GTATAATTTTTTCACATATCTGG - Intergenic
1178253045 21:31023057-31023079 TTCCAATGTTTTGACATCTTGGG + Intergenic
1178782858 21:35622679-35622701 TCCTGATGTTTTGACATCTGAGG + Intronic
1180190201 21:46159268-46159290 TTACAATGCTTTGACCTCTCGGG + Intergenic
1180938131 22:19639392-19639414 TTATGATGTTTTGATATCTTGGG + Intergenic
1181308843 22:21932833-21932855 TTATGATGCTTTGACAACTTGGG + Intronic
1184000439 22:41669381-41669403 GTCTTATGTTTTGACATCTTGGG + Intergenic
1184053581 22:42027966-42027988 TAAAAATGTTTTCTCATCTCAGG - Exonic
1184285167 22:43466553-43466575 TTCTGATGCTTTGACATCTGAGG + Intronic
949128554 3:474265-474287 TTATCATCATTTGACATCTGCGG - Intergenic
949186196 3:1194879-1194901 TTTTGATGCTTTGACATCTAGGG + Intronic
949705581 3:6813230-6813252 TTATAATAGTTTGCCATATCTGG - Intronic
950787947 3:15451261-15451283 TTAGAATGTTTTGATCTCTTTGG - Exonic
951323055 3:21271009-21271031 TTCTGATGTTTGGACATGTCCGG + Intergenic
952582087 3:34846414-34846436 TTAAAATGTTTTAAACTCTCTGG + Intergenic
953146931 3:40286211-40286233 TTAAATTGTTTTGAGATCTTTGG - Intergenic
954982702 3:54760773-54760795 TAATTATGTTTTGGCCTCTCTGG + Intronic
955829215 3:62983337-62983359 TTCTGATGTCTTCACATCTCGGG - Intergenic
955860943 3:63329728-63329750 TGAGAAAGTTTTGACATTTCTGG - Intronic
956289640 3:67647924-67647946 TTATCATGTGCTGCCATCTCAGG - Intronic
957179982 3:76864134-76864156 TTATAATTTTTTAAAATCTGTGG - Intronic
957401686 3:79723647-79723669 TTTTAATGCTTTGATATCTATGG + Intronic
958212649 3:90508136-90508158 TTATAATGTCTTGAGACCTATGG - Intergenic
958447004 3:94227520-94227542 TTCTGATATTTTGACATCTTGGG - Intergenic
960707033 3:120491645-120491667 TTATAATGTCTTGTAATGTCTGG - Intergenic
960827400 3:121804604-121804626 ATATAATGTTTTTTCATCTCTGG + Intronic
961868457 3:129971626-129971648 TTCTGATGCTTTGACATCTGAGG - Intergenic
961872200 3:129996652-129996674 TTCTGATGCTTTGACATCTGGGG - Intergenic
962477463 3:135768289-135768311 TTATCATTATTTTACATCTCAGG - Intergenic
962975435 3:140442105-140442127 TTCTGATGTTTTGACATCTGGGG + Intronic
965895951 3:173576134-173576156 TGATAATATTTTGACATATTGGG + Intronic
965994229 3:174859848-174859870 TAATTAAGTTTTGCCATCTCTGG + Intronic
966003868 3:174983893-174983915 TTTTTATATTTTGACATCTTTGG - Intronic
966112813 3:176424120-176424142 ATATAATGTTTTGAATTGTCAGG - Intergenic
966215912 3:177501971-177501993 TTAAAATGTGTAAACATCTCAGG + Intergenic
966259091 3:177953770-177953792 ATATGATGTTTTGACATCTTAGG - Intergenic
966558143 3:181287024-181287046 TTAGCATATTTTGAAATCTCTGG + Intergenic
967062060 3:185881395-185881417 TTCTGATGGTTTGACATCTGGGG + Intergenic
967326612 3:188246853-188246875 TAATAATTTATTGACATCTGAGG + Intronic
969157178 4:5221328-5221350 TTTTATTTTCTTGACATCTCAGG - Intronic
969242927 4:5913057-5913079 TTGTGATGTTTTGCCATCTTGGG - Intronic
970448282 4:16141875-16141897 TTTTGATGCTTTGACATCTTGGG - Intergenic
972299677 4:37773085-37773107 TTTGGATGCTTTGACATCTCGGG + Intergenic
972810328 4:42578190-42578212 TTAGGATATTTTGATATCTCAGG - Intronic
974305931 4:60140180-60140202 TTATAATGCTTTGACATTTTGGG + Intergenic
974671665 4:65037913-65037935 TTATAACAGTTTGATATCTCAGG - Intergenic
975223393 4:71840486-71840508 TTCTGATATTTTGACATCTCGGG - Intergenic
975914759 4:79311054-79311076 TTATAAAGCTTTGAATTCTCAGG + Intronic
978298946 4:107243288-107243310 TTGAAATGTTATTACATCTCAGG + Intronic
978895643 4:113884465-113884487 TTATCATGCTTTGACATCTTGGG + Intergenic
980668746 4:135974642-135974664 TTATATTGTTTTGAAAATTCAGG - Intergenic
981189462 4:141843916-141843938 TTTTAATGTTTTGATGTCCCAGG - Intergenic
981304914 4:143237089-143237111 TTTGAATCTTTTGACATCTTTGG - Intergenic
981571285 4:146153389-146153411 TTAGAAGGTTTTGCCAACTCAGG - Intergenic
981737059 4:147964033-147964055 TTCTGATGTTTTGACATCTGGGG + Intronic
982855851 4:160382026-160382048 TTATAATGATGTGACATCCAGGG + Intergenic
983809064 4:172035138-172035160 TTATACTATTTTGAAATATCAGG - Intronic
985197180 4:187443758-187443780 TTATGATGCTTTGACATATTTGG - Intergenic
986060530 5:4186038-4186060 TTAGAAGGTATGGACATCTCTGG - Intergenic
986352060 5:6889533-6889555 TTCTAATGCTTTAACATCTGGGG - Intergenic
986552023 5:8967274-8967296 TTATGATGTTTTGACATCTTTGG - Intergenic
986834475 5:11620180-11620202 TGCTGATGTTTTGACATCTTGGG + Intronic
988226623 5:28420964-28420986 TTTGAATGTTTTAACATCTCTGG - Intergenic
988423373 5:31033955-31033977 TTTAATTGTGTTGACATCTCAGG + Intergenic
988492537 5:31717084-31717106 TCTTAATGTTTTGGCATCTGGGG - Intronic
989776104 5:45208546-45208568 TTTTAATGGTTTGACATCAGAGG + Intergenic
989823309 5:45822256-45822278 TTAAACTGTTTTGACATTTATGG + Intergenic
989958579 5:50383605-50383627 TTAGATTGTTTTGAAATCTTGGG - Intergenic
991557586 5:67912854-67912876 TCATGATGTTTTGACATCTTGGG - Intergenic
992253965 5:74903258-74903280 TTCTGATGTTTTGACATCAGGGG + Intergenic
992544462 5:77797969-77797991 TAATAACCTTTCGACATCTCAGG + Intronic
992937217 5:81720073-81720095 TTATGATGCTTTGACATCTTGGG - Intronic
993295726 5:86137632-86137654 ATATATTTTTTTGTCATCTCTGG - Intergenic
993480666 5:88420866-88420888 TTATGATTTTCTGACCTCTCTGG - Intergenic
995230238 5:109753193-109753215 TCATACTGTCCTGACATCTCAGG + Intronic
995425526 5:112017810-112017832 TTTTCATGTTTTCAGATCTCAGG + Intergenic
996034917 5:118748129-118748151 TTATATTGTTTTTATATCTCAGG - Intergenic
996204507 5:120715729-120715751 TTTTTATGTTTGAACATCTCAGG + Intergenic
998258077 5:140605041-140605063 TTATAAGGTTTTAACCTCTTTGG + Intergenic
998548177 5:143049983-143050005 TTATAATCTTATGACAGCTCTGG + Intronic
999012455 5:148057615-148057637 TTATTATATTTTCACATTTCTGG + Intronic
1000460146 5:161505612-161505634 TTAAAGTGTGTTGACATTTCTGG - Intronic
1000831654 5:166109559-166109581 TTATAATATTTTTATGTCTCAGG + Intergenic
1001200579 5:169712356-169712378 TTATAAACTCTTGACTTCTCTGG + Intronic
1001549967 5:172595656-172595678 TTCTGATGCTTTGACATCTGTGG - Intergenic
1002049176 5:176560070-176560092 TTATGATGCTTTGACATCTTTGG - Intronic
1002786538 6:404603-404625 TCAGAATGTTTCGACATCCCAGG - Intronic
1002830548 6:816546-816568 TTCTGATGCTTTGACATCTGGGG + Intergenic
1003160503 6:3630253-3630275 TTTTGATGTTTTGACATGTTGGG + Intergenic
1003223222 6:4180443-4180465 GTATAATGAATTGACAACTCTGG + Intergenic
1003778860 6:9399801-9399823 TTATTATAATTTGACAACTCTGG - Intergenic
1004314031 6:14570882-14570904 TTCTGATGCTTTGACATCTGGGG + Intergenic
1007844079 6:44739501-44739523 CTAAAATGTTTTGACAGCTCAGG - Intergenic
1009589087 6:65643070-65643092 TCACAATGTTTTGGCATCTCAGG - Intronic
1009671501 6:66758141-66758163 TTATAATGTTTTGAGAACAAAGG + Intergenic
1009897137 6:69765515-69765537 ATATTATGTTTTGAGATCTGAGG + Intronic
1010563075 6:77374575-77374597 TTATTATGTTTTTAATTCTCTGG - Intergenic
1010610241 6:77945935-77945957 CTCTGATGTTTTGACATCTGGGG + Intergenic
1010731646 6:79397538-79397560 TTATTATTTTTTGGCATCTCAGG - Intergenic
1010748633 6:79593071-79593093 TTATAATGTCTTGGCAACACTGG - Intergenic
1012135305 6:95548476-95548498 TTCTGATGCTTTGACATCTCAGG + Intergenic
1012459453 6:99444426-99444448 TTCTGATGCTTTGACATCTAGGG + Intronic
1012468258 6:99539572-99539594 TTATAATATTTTTGTATCTCTGG - Intergenic
1012817162 6:104038767-104038789 TTACAATGATTTGACTTCTCTGG - Intergenic
1012924276 6:105251788-105251810 TTATGATGTTTTGACATCTTGGG - Intergenic
1014440442 6:121467882-121467904 ATAAGAGGTTTTGACATCTCAGG + Intergenic
1014826463 6:126053302-126053324 TTCTGATGTTTTGACATCTGGGG + Intergenic
1015593776 6:134846809-134846831 TTATACTATTTTGACATATTAGG + Intergenic
1016557487 6:145354713-145354735 TTAGAATGTTTAGGCTTCTCTGG + Intergenic
1017520542 6:155198005-155198027 TTATCATTTTTTGGGATCTCTGG + Intronic
1017834140 6:158161642-158161664 TAAGAATGCTTTGACATCTTAGG + Intronic
1018468084 6:164070415-164070437 TTAAAATATTTTGAGAACTCAGG + Intergenic
1019081769 6:169436908-169436930 TTATAATGTATTTTTATCTCGGG - Intergenic
1020959828 7:14788372-14788394 TTTTCATGCTTTGACATCTTGGG + Intronic
1021512426 7:21448929-21448951 GTATTATGCTTTGACATCTGAGG + Intronic
1021528387 7:21615361-21615383 TTATAATGTCTTGAAATATGTGG + Intronic
1021783773 7:24132959-24132981 TTTTGATGTTTTGACATCTGGGG - Intergenic
1021966725 7:25927287-25927309 TTCGGATGTTTTGACATCTTGGG - Intergenic
1023024797 7:36040768-36040790 TTATAAAACTTTGACATCTGGGG - Intergenic
1023317452 7:38954327-38954349 TTAATATGTTGTGACCTCTCAGG - Intergenic
1023702307 7:42904912-42904934 TTATACTAATTTCACATCTCTGG + Intergenic
1024661442 7:51498959-51498981 TAAAAATATCTTGACATCTCTGG - Intergenic
1024800251 7:53068996-53069018 CTGTAATGTTTTGAGATCCCAGG - Intergenic
1024832487 7:53477847-53477869 TTATGTAGTTTTGTCATCTCTGG - Intergenic
1025866229 7:65384017-65384039 TTATATTGTTGTGACTTCTGAGG + Intronic
1027826361 7:83121296-83121318 TTTTAAATTTTTGACAACTCTGG - Intronic
1028061926 7:86330434-86330456 TAATGATGTTTTGATATCTTGGG + Intergenic
1028064947 7:86372118-86372140 TTTTAATATTATCACATCTCAGG - Intergenic
1028081385 7:86581607-86581629 TTCTGACGTTTTGATATCTCTGG - Intergenic
1028184234 7:87762761-87762783 TTTTAATATATTGACATATCTGG - Intronic
1028445011 7:90912152-90912174 TAAGAATATTTTGCCATCTCAGG - Intronic
1028795429 7:94896545-94896567 TTTTAATGCTTTTACATCTGGGG + Intergenic
1028963717 7:96778239-96778261 TTTTACTGTTTTGTCTTCTCAGG - Intergenic
1029005476 7:97204630-97204652 TTATAATCTGTTTACACCTCTGG + Intergenic
1029603240 7:101582301-101582323 TTATGATGCTTTGACTTCTGGGG - Intergenic
1030584010 7:111394080-111394102 TTAAAATATTTTATCATCTCTGG + Intronic
1030912763 7:115272568-115272590 TTATAATGTTTTTATGTCTGTGG - Intergenic
1031299023 7:120041164-120041186 TTCTAGTTTTTTCACATCTCTGG - Intergenic
1032596625 7:133247427-133247449 TTAAAATGCTTTGACCTCTTTGG - Intergenic
1033035708 7:137874013-137874035 TCCTAATGCTTTGACATCTAGGG - Intergenic
1033577541 7:142700814-142700836 TTCTGATGTTTTGACATCTGAGG + Intergenic
1033829224 7:145232236-145232258 TTATAACTTTTTAACAGCTCTGG + Intergenic
1034710714 7:153189204-153189226 TTATGATGTTTTGACATCTTGGG + Intergenic
1036097914 8:5744320-5744342 TTATAAACTTTTCACATGTCAGG - Intergenic
1038051050 8:23811836-23811858 TTATAATGTTTTGACATTTTGGG - Intergenic
1039301987 8:36219790-36219812 TTATGAAGCTTTGACATCTTCGG + Intergenic
1040140550 8:43904809-43904831 TTTTAATGCTTTGAGGTCTCTGG + Intergenic
1040140604 8:43905824-43905846 TTTTAATGCTTTGAGGTCTCTGG + Intergenic
1040914506 8:52555346-52555368 TTCCAATGCTTTGACATCTTCGG + Intronic
1041650357 8:60296230-60296252 TTAAAATTTTGTGGCATCTCTGG - Intergenic
1041768399 8:61445038-61445060 ATTTAATGCTTTGACATCTGAGG - Intronic
1042161493 8:65900945-65900967 TTTTCATGTTTTGGCAACTCTGG - Intergenic
1043112312 8:76201275-76201297 TTTTGATGTTTTGACATCTGGGG - Intergenic
1043173310 8:76992879-76992901 TTATAATGTTTTCACGTTTTGGG - Intronic
1043320706 8:78982570-78982592 TTCTGATGTTTTGACATCTGGGG + Intergenic
1044958585 8:97506986-97507008 TTATAATGTCTTGACTTCCATGG - Intergenic
1045551141 8:103173699-103173721 GTATAAAGTTTGGAAATCTCTGG - Intronic
1045626397 8:104056807-104056829 TTATAGAGTTTTTACCTCTCAGG - Intronic
1046527713 8:115402818-115402840 TTATAATGTTTTCTCATTTAGGG - Intergenic
1046546626 8:115659932-115659954 TTAGAATGTTTTTACATTACAGG - Intronic
1048543798 8:135367380-135367402 TTCTAATGCTTTGAAATCTGCGG + Intergenic
1048711273 8:137213808-137213830 TTATGATGTTTGGACATCGTTGG + Intergenic
1049915532 9:314226-314248 TTAATATGTTTTGACAAATCTGG - Intronic
1050514664 9:6430448-6430470 TTATGATGTTTTGACATCTTTGG + Intronic
1052009662 9:23391046-23391068 TTTTAATGTTTTGCCAACTGAGG + Intergenic
1052140809 9:24980218-24980240 TTATGATGCTTTGACATCTTGGG - Intergenic
1052432938 9:28391018-28391040 TTTTAATGGTTTTACATGTCTGG - Intronic
1052891038 9:33700637-33700659 TTCTGATGTTTTGACATCTGGGG + Intergenic
1054710923 9:68509965-68509987 TTCTAATGCTTTGACATCTTGGG - Intronic
1055250091 9:74293509-74293531 TCATGATGTTTTGACATCCGAGG + Intergenic
1055836585 9:80449831-80449853 TTTTGATGTTTTGACATCTGAGG - Intergenic
1056456804 9:86768165-86768187 TTCTGATGTTTTGACCTCTGAGG - Intergenic
1056681826 9:88725638-88725660 TTCTGATGCTTTGACATCTTGGG - Intergenic
1056926203 9:90836793-90836815 TTATAATGTCATGACTTCTTGGG - Intronic
1057184447 9:93049054-93049076 TTCTGATGCTTTGACATCTTGGG - Intergenic
1058564489 9:106267270-106267292 TTGTAATGTTTTAAAATTTCAGG + Intergenic
1059036076 9:110754942-110754964 TTATAATTTGTTGACATCATTGG + Intronic
1059857982 9:118422462-118422484 TTATAATTTCTGAACATCTCAGG + Intergenic
1059960798 9:119562621-119562643 TTTTGATGTTTTGACATCTTGGG - Intergenic
1062655484 9:137602567-137602589 TTATTATGCTTTGACATCTTGGG + Intergenic
1185794728 X:2955164-2955186 TTCTGATGCTTTGACATCTTAGG - Intronic
1185978860 X:4753154-4753176 TTACAACGTTTTGACAATTCCGG + Intergenic
1186375186 X:8991036-8991058 TTATGATGCTTTGACATCTTGGG + Intergenic
1186830909 X:13389548-13389570 TTTTAATGCTTTGACATCTTGGG + Intergenic
1187237845 X:17484887-17484909 TTTTGATGCTTTGACATCTTGGG - Intronic
1187240336 X:17507291-17507313 TACTGATGTTTTGACATCTGGGG + Intronic
1188083656 X:25876753-25876775 TTATAATGTTCTCACTTCTGAGG - Intergenic
1188264801 X:28059589-28059611 TTAAAACTATTTGACATCTCTGG + Intergenic
1189094094 X:38119664-38119686 ATATAATGTTTTCATTTCTCTGG + Intronic
1189584552 X:42444846-42444868 TTAGAAGATTTTGAAATCTCTGG + Intergenic
1190240248 X:48652759-48652781 TCATGATGCTTTGACATCTTGGG + Intergenic
1194155686 X:90385596-90385618 TTCTAATGTTTTAACCTTTCTGG + Intergenic
1194532252 X:95065242-95065264 TTATTATATTTTCACATCTGTGG - Intergenic
1195710782 X:107772311-107772333 ATTTAATGATTTGACATTTCAGG - Intronic
1196385727 X:115147347-115147369 TTATATTTTCTTGACATCTTAGG + Intronic
1196474846 X:116070330-116070352 TTCTATTGTTGTGACATCTTTGG + Intergenic
1198689724 X:139267738-139267760 TTAAAATGTGTTGTGATCTCTGG + Intergenic
1200422195 Y:2983720-2983742 TTATTATTTTTTAACTTCTCAGG + Intergenic
1200502035 Y:3962535-3962557 TTCTAATGTTTTAACCTTTCTGG + Intergenic
1200544517 Y:4503380-4503402 TTATAATGTTCTAACCTGTCTGG - Intergenic
1201960954 Y:19680452-19680474 TTATAATTTTTTGAAGCCTCTGG + Intergenic
1201965998 Y:19736673-19736695 TTATATGGTTTTGACATTTCTGG + Intronic