ID: 1143381792

View in Genome Browser
Species Human (GRCh38)
Location 17:6501290-6501312
Sequence TATAATGTTTTGACATCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 2, 2: 6, 3: 37, 4: 313}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143381790_1143381792 2 Left 1143381790 17:6501265-6501287 CCTATATTCATCATGCTTGTTAT 0: 1
1: 0
2: 1
3: 29
4: 272
Right 1143381792 17:6501290-6501312 TATAATGTTTTGACATCTCTGGG 0: 1
1: 2
2: 6
3: 37
4: 313
1143381787_1143381792 23 Left 1143381787 17:6501244-6501266 CCTGGGGAATGGGGTGACACCCC 0: 1
1: 0
2: 8
3: 289
4: 4592
Right 1143381792 17:6501290-6501312 TATAATGTTTTGACATCTCTGGG 0: 1
1: 2
2: 6
3: 37
4: 313
1143381788_1143381792 4 Left 1143381788 17:6501263-6501285 CCCCTATATTCATCATGCTTGTT 0: 1
1: 0
2: 2
3: 38
4: 222
Right 1143381792 17:6501290-6501312 TATAATGTTTTGACATCTCTGGG 0: 1
1: 2
2: 6
3: 37
4: 313
1143381789_1143381792 3 Left 1143381789 17:6501264-6501286 CCCTATATTCATCATGCTTGTTA 0: 1
1: 0
2: 1
3: 9
4: 240
Right 1143381792 17:6501290-6501312 TATAATGTTTTGACATCTCTGGG 0: 1
1: 2
2: 6
3: 37
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143381792 Original CRISPR TATAATGTTTTGACATCTCT GGG Intronic
901950114 1:12738289-12738311 TATTATCTTTTTATATCTCTAGG - Intergenic
904995075 1:34625453-34625475 TATAATGTTTTGACATCTTTGGG + Intergenic
907368959 1:53986009-53986031 TAGACTGTTTTTTCATCTCTAGG - Intergenic
907616543 1:55932482-55932504 AATGATATTTTGTCATCTCTGGG + Intergenic
907998232 1:59654501-59654523 TGTAATCTTTTGAGATCCCTTGG + Intronic
909361874 1:74769330-74769352 TATAATTTATTGAAATATCTGGG - Intergenic
909438447 1:75671366-75671388 TATGATGTTTTGACATCTGAGGG - Intergenic
909635871 1:77816663-77816685 CATAATGTTTTGACATAGCTAGG + Intronic
911218933 1:95226589-95226611 TATAAAGTTTTGACATTACTGGG - Intronic
911288546 1:96028013-96028035 CCTAATGTTATGACATCCCTGGG + Intergenic
911669450 1:100591857-100591879 TATAATGTTATGACAGGCCTAGG + Intergenic
912904159 1:113686401-113686423 TAGAATGTTTTGACTTAACTCGG + Intergenic
913669600 1:121083858-121083880 TATACTGTTGTAACAGCTCTTGG - Intergenic
914021358 1:143871257-143871279 TATACTGTTGTAACAGCTCTTGG - Intergenic
914659848 1:149779175-149779197 TATACTGTTGTAACAGCTCTTGG - Intergenic
914885516 1:151581297-151581319 TATAATGTTTGCATATTTCTAGG + Intronic
916673466 1:167045907-167045929 TATAATCTCTTGAAATTTCTGGG + Intergenic
916728731 1:167547344-167547366 TATAATGTTTTTCCATGTCTGGG - Intronic
917136738 1:171795345-171795367 AATTATGTTTTCAGATCTCTTGG + Intronic
917844139 1:179006314-179006336 TTTAATGTTCTGAGGTCTCTGGG + Intergenic
918155015 1:181836175-181836197 TATAATATCTTGAGAACTCTAGG + Intergenic
918675804 1:187283829-187283851 TATAATACTTTGACTTTTCTAGG + Intergenic
919989564 1:202699944-202699966 TACAAAGTTTTGAAATCTTTGGG + Intronic
920602187 1:207338366-207338388 TACAATTTTATGACTTCTCTTGG + Intronic
922492563 1:226029914-226029936 CATAATGTTTTGGCACCTGTGGG - Intergenic
923226607 1:231943642-231943664 TATGATGCTTTGACATCTTGGGG - Intronic
923811633 1:237324478-237324500 TATACTGTTTTCACATCTCTTGG + Intronic
1063535319 10:6877098-6877120 TATGATGCTTTGACATCTCGGGG - Intergenic
1063787207 10:9399430-9399452 AAGAATGTTTTGCTATCTCTTGG - Intergenic
1064916731 10:20466402-20466424 TATGATGTTTTGAAATTCCTAGG - Intergenic
1065529549 10:26654371-26654393 TATAATGTTTTAATATTTGTTGG - Intergenic
1065557392 10:26930554-26930576 TATAATGTTTTAATATTTGTTGG + Intergenic
1065571961 10:27080444-27080466 TTTAATGTTTTAATATTTCTGGG - Intronic
1066486672 10:35852309-35852331 TATGATGTTTTGACCTCTTGGGG - Intergenic
1066487169 10:35858291-35858313 TATTATGTTATGGAATCTCTGGG - Intergenic
1067307662 10:45079921-45079943 TATGATGTTTTGACCTCTTGGGG - Intergenic
1067516595 10:46952218-46952240 TATAATATGTTGACATGGCTAGG - Intronic
1067645656 10:48099575-48099597 TATAATATGTTGACATGGCTAGG + Intergenic
1068362149 10:55990539-55990561 TATAATGTTTAAACATGTCTAGG + Intergenic
1068378745 10:56219073-56219095 TATAAAATTAAGACATCTCTAGG + Intergenic
1068535562 10:58237340-58237362 TATAATGTTATACCATCCCTGGG - Intronic
1069315202 10:67090448-67090470 TATATTGTGTTCACCTCTCTAGG + Intronic
1071745482 10:88414257-88414279 TCTCATGTTTTGTCAACTCTAGG - Intronic
1071904882 10:90161868-90161890 TAGAATGTTTTGTCTTCTGTGGG - Intergenic
1074670671 10:115786890-115786912 CATAATGTTTAGATTTCTCTAGG - Intronic
1075169271 10:120098035-120098057 TTTAATGTTTTTACTTCTTTTGG + Intergenic
1075552021 10:123399907-123399929 TATGATGCTTTGACATCTTGGGG + Intergenic
1075609879 10:123844155-123844177 TATAATTTTGTAACATCTCTGGG - Intronic
1078082385 11:8213625-8213647 TACAAAGTTTTGACATTTCCTGG + Intergenic
1078785145 11:14483592-14483614 TAAAATATTTTAACAACTCTGGG - Intronic
1079195243 11:18321019-18321041 TATACTGTTTGTACATTTCTAGG - Intronic
1079398897 11:20089648-20089670 TAGAAAGCTTTGACATTTCTTGG - Intronic
1079733316 11:23962678-23962700 GATTATGTTGTGATATCTCTGGG - Intergenic
1081882357 11:46464608-46464630 TATGATGCTTTGACATCTTAGGG + Intronic
1084741834 11:71145208-71145230 TCTAATCTTTTGGCTTCTCTGGG + Intronic
1085236147 11:75017137-75017159 TATAATGTCCTTACAACTCTTGG + Intronic
1087125857 11:94625258-94625280 TAAAAAGTTATGATATCTCTAGG - Intergenic
1087238295 11:95746387-95746409 TATATTGATTTTTCATCTCTGGG + Intergenic
1087253552 11:95930240-95930262 TAAAATGTTTTGGCTTTTCTGGG + Intergenic
1088942331 11:114472299-114472321 TTTAATCTTTTGGCTTCTCTGGG + Intergenic
1090981881 11:131729927-131729949 GATAATGTTTTAATTTCTCTCGG + Intronic
1092987424 12:13859897-13859919 TGTAATGTTATGGCATTTCTTGG - Intronic
1094487227 12:30934733-30934755 TCTAATGTTTTGGCTTCCCTGGG - Intronic
1095358023 12:41300088-41300110 TATATTGTTATGTCATCTTTAGG + Intronic
1095556553 12:43513181-43513203 TAGAATGTTTTGATATCTGTAGG - Intronic
1097326186 12:58279159-58279181 CATAATGTTTTGACATTTTATGG + Intergenic
1097362259 12:58670937-58670959 TATGATGTTTTGACATCTTGAGG - Intronic
1097817776 12:64094745-64094767 AATTAGGTTTTGACATCTCTAGG + Intronic
1098195873 12:68001744-68001766 TTTCATGGTTTGAAATCTCTAGG + Intergenic
1098323154 12:69271289-69271311 TATATTGTTGTGTCATTTCTTGG + Exonic
1101799883 12:108012102-108012124 TATAAAGTTCTGATATCTCATGG + Intergenic
1104217768 12:126751089-126751111 AATAATGTTTTGACATGTTTTGG + Intergenic
1105967526 13:25398173-25398195 TATATTTTTTTGACATATTTTGG - Intronic
1107895868 13:44962576-44962598 TATGATGTTATGACATTACTGGG - Intronic
1108231058 13:48341394-48341416 TATAATGTTTTCATTTCTCTTGG + Intronic
1109796014 13:67314220-67314242 AATTATGCTTGGACATCTCTGGG - Intergenic
1111058365 13:82979882-82979904 TATGATGCTTTGACATCTCAGGG + Intergenic
1111253489 13:85637434-85637456 GATAATGTTTTGAAATCTCAAGG - Intergenic
1111338510 13:86853074-86853096 TATAATGTTTTGTATTCTTTTGG - Intergenic
1112107356 13:96255360-96255382 GATAATGTTTTCACTTCTGTGGG - Intronic
1112285085 13:98096866-98096888 TGTGATGTTTTAACATCTCCTGG - Intergenic
1114540610 14:23454822-23454844 TATGAGGTTTTGACATCTTAGGG - Intergenic
1117036226 14:51732592-51732614 TATACTGTTTTAAACTCTCTAGG - Intergenic
1118298574 14:64593618-64593640 TGTAATGTTTTCATTTCTCTTGG - Intergenic
1118534265 14:66742082-66742104 TAGAGTGTTTTGACATTTTTAGG - Intronic
1119151968 14:72368946-72368968 TCTAATCTTTTGACTTCCCTGGG + Intronic
1119230559 14:72976021-72976043 TCTAATACTTGGACATCTCTAGG + Intronic
1119339932 14:73868457-73868479 TAGGATGTTTTGACATCTTAGGG + Intronic
1120062699 14:80002752-80002774 CATAATCTTTTCACTTCTCTGGG - Intergenic
1120066546 14:80047651-80047673 TATGATAGTTTGACTTCTCTGGG + Intergenic
1120313029 14:82855342-82855364 TTTAATGTTAGGACATCTCTGGG + Intergenic
1120865293 14:89291211-89291233 TAACATGTTTAGTCATCTCTCGG - Intronic
1125909373 15:43422200-43422222 TATAATTTTGTGCCATCTGTAGG - Intronic
1126402489 15:48286949-48286971 GATATTGTTTTTACATCCCTGGG - Intronic
1126620149 15:50630466-50630488 TATAATGTTGTTATATCTGTTGG + Intronic
1126749786 15:51864948-51864970 TATGATGCTTTGACATCTTGGGG - Intronic
1127989487 15:64102153-64102175 TATTATTTTTTGACATCCCTTGG + Intronic
1128267849 15:66282200-66282222 TTTAATGCTTTGACAATTCTGGG - Intergenic
1130814111 15:87412698-87412720 TATAAACTTTTCTCATCTCTGGG - Intergenic
1131024756 15:89130838-89130860 TCTAATGTTTTGGCTTCCCTGGG - Intronic
1131257116 15:90870288-90870310 TATCATGATTTAACCTCTCTGGG + Intronic
1131970188 15:97884298-97884320 TATAATTTTTAAAAATCTCTAGG + Intergenic
1134214328 16:12305116-12305138 TCTAATGATTTGAAATCTGTGGG + Intronic
1134848918 16:17464640-17464662 TATAATAGTTTGACATATTTTGG - Intronic
1135152919 16:20025468-20025490 TATAATCTTTCTACATTTCTGGG + Intergenic
1135179962 16:20263804-20263826 TATGATGTTTTGACATCTTGTGG - Intergenic
1136299162 16:29321623-29321645 TAAAATATTTTGAGATGTCTTGG - Intergenic
1136653642 16:31695396-31695418 TCTAATGTTTTGGCTTCCCTGGG + Intergenic
1137450311 16:48567768-48567790 TATGATGTTTTGACATCTTGGGG + Intronic
1138641490 16:58391507-58391529 TATGATGCTTTGACATCTTGGGG - Intronic
1139107683 16:63847815-63847837 TATAATATTTTAGCATCTCAGGG - Intergenic
1140348750 16:74241100-74241122 CATAATCTTTTGGCATCCCTGGG + Intergenic
1140867748 16:79078763-79078785 TAGAATGTCTTCACTTCTCTTGG + Intronic
1142060857 16:88028178-88028200 TAAAATATTTTGAGATGTCTTGG - Intronic
1143381792 17:6501290-6501312 TATAATGTTTTGACATCTCTGGG + Intronic
1144244144 17:13346443-13346465 TCTGATGTTTTGACATCTTGTGG - Intergenic
1147001045 17:37362553-37362575 TATAATGTTTATATATATCTGGG - Intronic
1153329807 18:3862322-3862344 TACAATGTTTTGACACCTCTAGG - Intronic
1153452571 18:5246021-5246043 TTTAATTTTTTGAAATCACTGGG - Intergenic
1154028667 18:10730598-10730620 TATCATGTTTTCAAATATCTTGG + Intronic
1154049171 18:10937134-10937156 TTTAATTTTTTGCCATCTCCTGG - Intronic
1154256297 18:12783496-12783518 TCCAATGTTTTGACTTCCCTGGG + Intergenic
1156348923 18:36286112-36286134 CAAATTGTTTTGACATCACTCGG + Intergenic
1156551276 18:38020255-38020277 TAGTATGTTTTCACATCTCTTGG + Intergenic
1156734148 18:40232204-40232226 TATAATTTTTTTCCATCACTGGG - Intergenic
1157044598 18:44085641-44085663 AATATTGTTTTGACTACTCTGGG - Intergenic
1158339978 18:56455384-56455406 TAAAATGTTTTGCCACCTCATGG - Intergenic
1159268370 18:66114065-66114087 TATAATGTTTGGACATTATTAGG + Intergenic
1160110959 18:76029979-76030001 TATAATTTATTGATATCTTTTGG + Intergenic
1162322939 19:9980550-9980572 TATAATGTCTCTTCATCTCTTGG + Intronic
1164813673 19:31177751-31177773 TATAATAACTTGACATCTCAGGG + Intergenic
1164875238 19:31680271-31680293 TCTCACGTTTTGGCATCTCTGGG - Intergenic
1165256916 19:34582510-34582532 TGTAATGTTTTGGCTTCCCTGGG + Intergenic
1165631827 19:37307580-37307602 CTTGATGTCTTGACATCTCTTGG + Intergenic
1166010166 19:39935641-39935663 GAGAATTTTTTTACATCTCTGGG - Intergenic
926758800 2:16258305-16258327 TATAATGTTTTGGTAACTTTAGG - Intergenic
926781356 2:16475374-16475396 GATAGTGTTTACACATCTCTGGG + Intergenic
927398043 2:22677978-22678000 TATATTTATTTGACATCTATTGG - Intergenic
930407625 2:50980415-50980437 TACAATATTTTGACAGCTTTTGG + Intronic
930496522 2:52151867-52151889 TAAAATGTTATGAAATCTCAAGG + Intergenic
930579378 2:53191805-53191827 ATTATTGTTTTGAGATCTCTGGG - Intergenic
932170156 2:69547741-69547763 TATAATATTTTCACATCTCTTGG - Intronic
932543596 2:72683677-72683699 TTTATTGTTTTGATATCTATGGG - Intronic
932797473 2:74709402-74709424 TATAATGTTTTAATATAGCTAGG - Intergenic
933523171 2:83401115-83401137 TATAATTTTATGAGATCTCTTGG + Intergenic
935132861 2:100274475-100274497 TATAATGTTTTCACATCTTGGGG + Exonic
935133613 2:100279573-100279595 TATGATATTTTGACATCTCAGGG + Exonic
935577624 2:104727218-104727240 TAAAATATTCTGACATTTCTGGG - Intergenic
935854500 2:107259449-107259471 TATGATGTTTTGATATCTTGGGG - Intergenic
937704678 2:124906072-124906094 TATGATGCTTTGACATCTTGAGG - Intronic
938416946 2:131111336-131111358 TCTAATTTTTTTCCATCTCTTGG + Intronic
939341857 2:140906226-140906248 TATAATTTTTTGAAATGTTTGGG + Intronic
939588526 2:144034204-144034226 GATAATTTTTTTAGATCTCTAGG + Intronic
941338530 2:164275651-164275673 TATAGTGTTTTGACATTTCTTGG + Intergenic
941362095 2:164563780-164563802 TAAAATGTTTTGTCATTTATGGG - Intronic
941828455 2:169926261-169926283 TATGATGTTTTGACATCTTGAGG - Intronic
941927614 2:170912138-170912160 TTTATTGTTTTGTCATCTGTGGG + Intergenic
942052853 2:172156824-172156846 TGTAATTTTTTGACATGTCTTGG + Intergenic
942649484 2:178151428-178151450 TAAAAGGTTTTAAAATCTCTTGG + Intergenic
942735725 2:179110429-179110451 TTTAATGTTATGACATTTTTTGG + Intronic
942773761 2:179555536-179555558 TAAAATGTTTTGACAAATATAGG + Intronic
942897266 2:181072116-181072138 TCTAATCTTTTGGCATCCCTGGG + Intronic
945482746 2:210362092-210362114 TATAACGTTTCAAAATCTCTGGG - Intergenic
945706882 2:213246152-213246174 AAAAAAGTTTTGAAATCTCTAGG + Intergenic
947319467 2:228899857-228899879 TATTCTGTTTTGATATCACTTGG - Intronic
947974566 2:234354455-234354477 GATAATGTTTGGAAAACTCTGGG - Intergenic
1168734984 20:126808-126830 TTTAGTGTTTTGACATTTATAGG + Intergenic
1169192488 20:3667061-3667083 TATGATGGTTTAACATCTCGGGG + Intergenic
1169479787 20:5969176-5969198 GATAATTTTTTGACAACTGTGGG + Intronic
1170004941 20:11657138-11657160 TAAAATGTTTTGACTACTATAGG - Intergenic
1170030335 20:11937669-11937691 TTTAATATTTTGACATATGTAGG - Intergenic
1170225407 20:13986739-13986761 TATTATGTTTTCATTTCTCTTGG + Intronic
1174174127 20:48634374-48634396 TCTTAAGTTTTCACATCTCTAGG + Intronic
1176518721 21:7808275-7808297 CAAAATGTTTTAACATCTTTTGG - Intergenic
1177054317 21:16281056-16281078 TATAATGTTTTTACAATTATTGG + Intergenic
1177474359 21:21599686-21599708 TAAAATGTTCATACATCTCTAGG - Intergenic
1178253046 21:31023058-31023080 TCCAATGTTTTGACATCTTGGGG + Intergenic
1178601056 21:33994427-33994449 CATATTGTTTTGCCATCTATAGG + Intergenic
1178652749 21:34438288-34438310 CAAAATGTTTTAACATCTTTTGG - Intergenic
1180190202 21:46159269-46159291 TACAATGCTTTGACCTCTCGGGG + Intergenic
1182057230 22:27369202-27369224 GATAAGGTTTTGACTTCTTTGGG + Intergenic
1184000440 22:41669382-41669404 TCTTATGTTTTGACATCTTGGGG + Intergenic
1185035120 22:48471056-48471078 TATATTGATTTCACATATCTTGG + Intergenic
949586351 3:5442313-5442335 GGTAATTTTTTGAGATCTCTTGG + Intergenic
950787946 3:15451260-15451282 TAGAATGTTTTGATCTCTTTGGG - Exonic
951629418 3:24702857-24702879 TATAAGGTTTTGAGTTCTCTTGG + Intergenic
952597873 3:35041211-35041233 TAGAATGTTTTTCCAGCTCTCGG + Intergenic
953159233 3:40403077-40403099 TACAATGTTTTGGCAGCTCACGG - Intronic
953668283 3:44941665-44941687 TCTAATCTTTTGTCTTCTCTGGG + Intronic
954982703 3:54760774-54760796 AATTATGTTTTGGCCTCTCTGGG + Intronic
955809821 3:62776055-62776077 TATAATGTCTTGGCATTACTAGG + Intronic
956277499 3:67518635-67518657 GTTAATTTTTTGACATCTTTTGG + Intronic
957131247 3:76224596-76224618 TATAATGTTTTACCAGCTATTGG + Intronic
957133311 3:76250844-76250866 TATGATGTTTTGAAATATCATGG - Intronic
957219528 3:77363968-77363990 TATAATGCTTTGGCATCCCAAGG - Intronic
957836438 3:85597553-85597575 TAAAATGTTTTGATACCTATAGG + Intronic
958508341 3:95011804-95011826 TATGATGTTTTGACATCTCTTGG - Intergenic
958536135 3:95407229-95407251 TATAATGTTTTGATACATCATGG + Intergenic
958816044 3:98916832-98916854 AATAATATTTTGACAGCTGTTGG - Intergenic
959095584 3:101951946-101951968 TCGAATGTTTTTAAATCTCTGGG + Intergenic
962435231 3:135360283-135360305 TTTGATGCTTTGATATCTCTTGG + Intergenic
962975436 3:140442106-140442128 TCTGATGTTTTGACATCTGGGGG + Intronic
963833833 3:150036408-150036430 TATAATCTGTTGAGAGCTCTGGG + Intronic
965049615 3:163628484-163628506 TTGAATGTTTTGACATTGCTAGG - Intergenic
965376539 3:167931459-167931481 TTTAATCTTTTGAGATATCTTGG - Intergenic
965844039 3:172940430-172940452 TTTGTTGTTTTGCCATCTCTGGG - Intronic
966003867 3:174983892-174983914 TTTTATATTTTGACATCTTTGGG - Intronic
966093141 3:176164468-176164490 TATGATGTTTTGATAACTATAGG - Intergenic
966454385 3:180098692-180098714 TATATAGTTTTGCCATGTCTGGG - Intergenic
966558144 3:181287025-181287047 TAGCATATTTTGAAATCTCTGGG + Intergenic
966716224 3:183015670-183015692 TTTGATGTTTTGTCATCTCTCGG + Intronic
967773702 3:193362539-193362561 TACAATGTTTTGTCACCCCTTGG - Intronic
968858789 4:3149916-3149938 GATCATGTCTTTACATCTCTGGG + Intronic
969845930 4:9920087-9920109 TATAACTTTTAGACATGTCTAGG + Intronic
970211394 4:13713763-13713785 TATATTGTTTTGATATGCCTTGG - Intergenic
971237158 4:24853179-24853201 CATAATGTGTTGATATTTCTAGG - Exonic
971546810 4:27896672-27896694 CATTATGTATTGCCATCTCTAGG + Intergenic
971736989 4:30466348-30466370 CATAATGTTTTGCCAGCTATAGG + Intergenic
972655114 4:41056626-41056648 AATACTGTGTTGACTTCTCTGGG - Intronic
972729052 4:41775286-41775308 TTAATTGTATTGACATCTCTTGG - Intergenic
972939973 4:44183787-44183809 TATCATGTTTTATCATCACTGGG - Intronic
973006963 4:45020646-45020668 AAAAATCTGTTGACATCTCTAGG + Intergenic
973954914 4:56053374-56053396 TTTAATATTTTGATATTTCTAGG + Intergenic
974578608 4:63764312-63764334 TATTCTGTTTTGACATTTCGTGG + Intergenic
977723772 4:100270606-100270628 TATAATGTTTTTAGGTCTCCAGG - Intergenic
977902344 4:102437162-102437184 TATGATGTTCTGCCATATCTAGG - Intergenic
978516360 4:109573024-109573046 TTTTATGTTTTGACATTGCTGGG - Intronic
978732281 4:112042272-112042294 GTTAATGTTTTAACATTTCTGGG + Intergenic
978895644 4:113884466-113884488 TATCATGCTTTGACATCTTGGGG + Intergenic
980236874 4:130119186-130119208 TATTAAGTCTGGACATCTCTTGG - Intergenic
980521656 4:133944272-133944294 TGAAATGTTTTAACATTTCTAGG + Intergenic
982300394 4:153872468-153872490 TATAATTTTTTGAAATCACATGG + Intergenic
982726015 4:158907346-158907368 TATAATCTTTTCACATCCCATGG + Exonic
983323250 4:166222157-166222179 TATAAAGTTTTTACATAACTTGG + Intergenic
983645607 4:169988228-169988250 TATTATATTTTCATATCTCTAGG - Exonic
985009105 4:185564196-185564218 TAGAATCTTTTTACATATCTAGG - Intergenic
986219584 5:5755898-5755920 CAGAATGTATTGACATCTTTAGG - Intergenic
986407794 5:7443827-7443849 TATTGTGTTTTAACATCCCTTGG + Intronic
986552022 5:8967273-8967295 TATGATGTTTTGACATCTTTGGG - Intergenic
988226622 5:28420963-28420985 TTGAATGTTTTAACATCTCTGGG - Intergenic
989702912 5:44292069-44292091 TATATTGTTTTCACTTTTCTTGG + Intergenic
991359969 5:65809613-65809635 TATAATGTTTTGACAATCTTCGG - Exonic
991557585 5:67912853-67912875 CATGATGTTTTGACATCTTGGGG - Intergenic
991942381 5:71865131-71865153 TCAACTGTTTTGACACCTCTGGG + Intergenic
992937216 5:81720072-81720094 TATGATGCTTTGACATCTTGGGG - Intronic
993480665 5:88420865-88420887 TATGATTTTCTGACCTCTCTGGG - Intergenic
993631123 5:90287076-90287098 TATTATGTTTGTACTTCTCTTGG - Intergenic
995401316 5:111745072-111745094 TATAATGTTTTGTTAACTTTGGG + Intronic
995888201 5:116919627-116919649 GATAATGTTCTGTGATCTCTTGG - Intergenic
995914985 5:117234384-117234406 TACAATCTTTTGACTTCCCTGGG + Intergenic
996034916 5:118748128-118748150 TATATTGTTTTTATATCTCAGGG - Intergenic
996505723 5:124265897-124265919 TATTTTGTTATGGCATCTCTAGG - Intergenic
996833380 5:127764643-127764665 TCTAATCTTTTGGCTTCTCTTGG + Intergenic
998548178 5:143049984-143050006 TATAATCTTATGACAGCTCTGGG + Intronic
999040546 5:148405441-148405463 TCCAATATTTTGACATCACTGGG - Intronic
1000460145 5:161505611-161505633 TAAAGTGTGTTGACATTTCTGGG - Intronic
1000489037 5:161886093-161886115 AATAATGTTTAAACTTCTCTGGG - Intronic
1000674344 5:164102808-164102830 TATAATGTTTTTAGTTTTCTGGG + Intergenic
1000933957 5:167285552-167285574 TATACTGTTTTGATTTCTTTTGG + Intronic
1001126749 5:169026289-169026311 TATGTTGTTTTGCCATTTCTAGG + Intronic
1001200580 5:169712357-169712379 TATAAACTCTTGACTTCTCTGGG + Intronic
1002049175 5:176560069-176560091 TATGATGCTTTGACATCTTTGGG - Intronic
1003223223 6:4180444-4180466 TATAATGAATTGACAACTCTGGG + Intergenic
1007814181 6:44508683-44508705 TATAATTTTTGTTCATCTCTTGG + Intergenic
1009589086 6:65643069-65643091 CACAATGTTTTGGCATCTCAGGG - Intronic
1009901601 6:69813704-69813726 TTTCCTGTTTTGACAACTCTAGG - Intergenic
1010018335 6:71130436-71130458 TTTCTTGTTTTGACAGCTCTGGG - Intergenic
1010052098 6:71517831-71517853 TATGATGTTATGACATACCTAGG + Intergenic
1010748632 6:79593070-79593092 TATAATGTCTTGGCAACACTGGG - Intergenic
1011377004 6:86699339-86699361 TTTCATGTTTTGTCAGCTCTTGG - Intergenic
1012135306 6:95548477-95548499 TCTGATGCTTTGACATCTCAGGG + Intergenic
1012804537 6:103877814-103877836 TGCAATATTTTGGCATCTCTGGG + Intergenic
1012924275 6:105251787-105251809 TATGATGTTTTGACATCTTGGGG - Intergenic
1013676848 6:112474062-112474084 TTGATTGTTTTGACATCTATAGG + Intergenic
1014874603 6:126642200-126642222 TATAATTTTAGGACATGTCTAGG - Intergenic
1015859899 6:137664845-137664867 TATAGTGTTTTGACACCTGATGG + Intergenic
1016542540 6:145181962-145181984 TAGAATGATTTGTAATCTCTAGG - Intergenic
1016548715 6:145253262-145253284 TATAATCATTTCACTTCTCTTGG + Intergenic
1016557488 6:145354714-145354736 TAGAATGTTTAGGCTTCTCTGGG + Intergenic
1016726512 6:147376171-147376193 TTTAATGTTATGACATATTTTGG - Intronic
1017520543 6:155198006-155198028 TATCATTTTTTGGGATCTCTGGG + Intronic
1022146280 7:27545055-27545077 TCTAAAGTTTTGACATTCCTTGG + Intronic
1022714466 7:32886277-32886299 TATAAATTTTTGACTTCTGTAGG - Intronic
1023063198 7:36349335-36349357 TATAATATTTTGAAATATTTTGG - Intronic
1023063199 7:36349381-36349403 TATAATATTTTGAAATATTTTGG - Intronic
1023396684 7:39758160-39758182 TATAATGCTTTGAAAACTGTTGG + Intergenic
1023702308 7:42904913-42904935 TATACTAATTTCACATCTCTGGG + Intergenic
1024213217 7:47224922-47224944 AAAAATGTTTTGGCAACTCTGGG + Intergenic
1028388490 7:90287302-90287324 TATAATGCTTTCATTTCTCTCGG + Intronic
1028486272 7:91361000-91361022 GATAATATTTTGTCATCTCGTGG - Intergenic
1030017190 7:105235088-105235110 TCTAATCTTTTGGCTTCTCTGGG - Intronic
1030492369 7:110254085-110254107 TGTAATCTTTTGACTTCCCTGGG - Intergenic
1032295017 7:130629164-130629186 TATAATGTTTTGTCCTTTTTTGG + Intronic
1033828607 7:145224282-145224304 TATAATATTTAGGAATCTCTAGG + Intergenic
1034710715 7:153189205-153189227 TATGATGTTTTGACATCTTGGGG + Intergenic
1035273660 7:157734562-157734584 TAAAATATTTGTACATCTCTGGG - Intronic
1036206678 8:6810747-6810769 TATTATGTTATGAAATCTCTTGG - Exonic
1037653326 8:20860847-20860869 TATATTTTTTTGACATATTTTGG + Intergenic
1037939921 8:22943728-22943750 TATGATGGTTTGACATCTTGAGG + Intronic
1038010981 8:23475559-23475581 TATATTGTATTGTCCTCTCTTGG + Intergenic
1038051049 8:23811835-23811857 TATAATGTTTTGACATTTTGGGG - Intergenic
1039175851 8:34804998-34805020 TATATTATTTTGATAACTCTGGG + Intergenic
1040378719 8:46851501-46851523 GAAAATATTTTGACATATCTTGG + Intergenic
1040515101 8:48128080-48128102 TAAAAGGTTTTGACATATTTTGG - Intergenic
1041650356 8:60296229-60296251 TAAAATTTTGTGGCATCTCTGGG - Intergenic
1042298885 8:67253622-67253644 TATAATGGTTTTTCATATCTAGG - Exonic
1042838960 8:73104563-73104585 TTTAATATTCTGACATTTCTTGG - Intronic
1043378874 8:79681622-79681644 TTCAATCTTTTGACTTCTCTGGG + Intergenic
1043698880 8:83258124-83258146 TATATTGTTTTGCAAGCTCTGGG + Intergenic
1043782087 8:84348836-84348858 TGGAAAGTTTTGACATTTCTGGG + Intronic
1044553550 8:93537727-93537749 TATAATGTCTTGGGTTCTCTTGG + Intergenic
1044958584 8:97506985-97507007 TATAATGTCTTGACTTCCATGGG - Intergenic
1045549853 8:103161921-103161943 TACAATCTGTTCACATCTCTGGG + Intronic
1047019457 8:120759324-120759346 TAGAATGCTTGGACATTTCTAGG - Intronic
1050514665 9:6430449-6430471 TATGATGTTTTGACATCTTTGGG + Intronic
1050713790 9:8496919-8496941 TCTAATCTTTTGGCTTCTCTGGG - Intronic
1051417930 9:16862174-16862196 CATAATGTTTTCATTTCTCTTGG - Intronic
1051536069 9:18159471-18159493 TATAAAGTTCTTACAACTCTGGG - Intergenic
1052140808 9:24980217-24980239 TATGATGCTTTGACATCTTGGGG - Intergenic
1052149519 9:25097336-25097358 TGAAATATTTTGAGATCTCTAGG - Intergenic
1052432937 9:28391017-28391039 TTTAATGGTTTTACATGTCTGGG - Intronic
1053463120 9:38285993-38286015 TACAATCTTTTGACTTCCCTGGG + Intergenic
1054710922 9:68509964-68509986 TCTAATGCTTTGACATCTTGGGG - Intronic
1054831779 9:69633147-69633169 TATTATTTTTTTAAATCTCTTGG + Intronic
1054883594 9:70171741-70171763 TTTAATCTTTTGGCTTCTCTGGG + Intronic
1055282403 9:74689588-74689610 TATTATGATTTAAGATCTCTTGG - Exonic
1055951013 9:81729714-81729736 TATATTGATTGGGCATCTCTAGG - Intergenic
1056073921 9:83018748-83018770 TATAATGTCTTGATACCTGTTGG - Intronic
1056678740 9:88698555-88698577 TATAGTGGTTTGACCTCTGTTGG - Intergenic
1056884406 9:90427281-90427303 TATAAAGATTTATCATCTCTTGG - Intergenic
1057116287 9:92525502-92525524 TATGATGCTGTGACGTCTCTAGG - Intronic
1057567844 9:96180756-96180778 ACTAATGTTTTGAGATTTCTGGG + Intergenic
1058058284 9:100471321-100471343 TATAATGTGTACACATCCCTAGG - Intronic
1059637353 9:116183913-116183935 TAAAATGTTTACACATCTGTAGG - Intronic
1059960797 9:119562620-119562642 TTTGATGTTTTGACATCTTGGGG - Intergenic
1062655485 9:137602568-137602590 TATTATGCTTTGACATCTTGGGG + Intergenic
1186326501 X:8482815-8482837 CTTAATGTTTTGAGCTCTCTGGG + Intergenic
1186375187 X:8991037-8991059 TATGATGCTTTGACATCTTGGGG + Intergenic
1186757619 X:12689322-12689344 TATATTTATTTTACATCTCTGGG - Intronic
1186830910 X:13389549-13389571 TTTAATGCTTTGACATCTTGGGG + Intergenic
1188208970 X:27395420-27395442 TATAATGTTTAGACACATTTTGG - Intergenic
1188730842 X:33644626-33644648 TTTCATGTTGTGACATGTCTGGG + Intergenic
1189094095 X:38119665-38119687 TATAATGTTTTCATTTCTCTGGG + Intronic
1189618049 X:42804945-42804967 TATACTTTTTTGACATATTTTGG - Intergenic
1192043550 X:67648075-67648097 TTTTATGTTTTTCCATCTCTTGG + Intronic
1193553003 X:82922137-82922159 TATAATATTTGCAAATCTCTGGG - Intergenic
1193947112 X:87752073-87752095 TATATTGTTTAGAAATCTTTTGG - Intergenic
1194102633 X:89725144-89725166 AATATTGTGTTGACATTTCTGGG + Intergenic
1194155687 X:90385597-90385619 TCTAATGTTTTAACCTTTCTGGG + Intergenic
1194586984 X:95747283-95747305 TACAATGTTATGACATCACTAGG - Intergenic
1195030078 X:100918485-100918507 GAAAATGTTTTGACATTTATTGG - Intronic
1195421686 X:104682478-104682500 TATTAGCTTTTGAAATCTCTTGG + Intronic
1197097834 X:122616346-122616368 TAGAATGATTTGAAATCTTTTGG + Intergenic
1197190572 X:123642969-123642991 TATAATGTTATCATACCTCTAGG - Intronic
1198634627 X:138682299-138682321 TATAATGCATTGCCATGTCTAGG + Intronic
1200455219 Y:3382421-3382443 AATATTGTGTTGACATTTCTGGG + Intergenic
1200502036 Y:3962536-3962558 TCTAATGTTTTAACCTTTCTGGG + Intergenic
1200544516 Y:4503379-4503401 TATAATGTTCTAACCTGTCTGGG - Intergenic
1201965999 Y:19736674-19736696 TATATGGTTTTGACATTTCTGGG + Intronic