ID: 1143381793

View in Genome Browser
Species Human (GRCh38)
Location 17:6501291-6501313
Sequence ATAATGTTTTGACATCTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 2, 2: 4, 3: 40, 4: 354}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143381787_1143381793 24 Left 1143381787 17:6501244-6501266 CCTGGGGAATGGGGTGACACCCC 0: 1
1: 0
2: 8
3: 289
4: 4592
Right 1143381793 17:6501291-6501313 ATAATGTTTTGACATCTCTGGGG 0: 1
1: 2
2: 4
3: 40
4: 354
1143381789_1143381793 4 Left 1143381789 17:6501264-6501286 CCCTATATTCATCATGCTTGTTA 0: 1
1: 0
2: 1
3: 9
4: 240
Right 1143381793 17:6501291-6501313 ATAATGTTTTGACATCTCTGGGG 0: 1
1: 2
2: 4
3: 40
4: 354
1143381790_1143381793 3 Left 1143381790 17:6501265-6501287 CCTATATTCATCATGCTTGTTAT 0: 1
1: 0
2: 1
3: 29
4: 272
Right 1143381793 17:6501291-6501313 ATAATGTTTTGACATCTCTGGGG 0: 1
1: 2
2: 4
3: 40
4: 354
1143381788_1143381793 5 Left 1143381788 17:6501263-6501285 CCCCTATATTCATCATGCTTGTT 0: 1
1: 0
2: 2
3: 38
4: 222
Right 1143381793 17:6501291-6501313 ATAATGTTTTGACATCTCTGGGG 0: 1
1: 2
2: 4
3: 40
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143381793 Original CRISPR ATAATGTTTTGACATCTCTG GGG Intronic
901339304 1:8480874-8480896 AAAATGTTTTGAGATATATGTGG - Intronic
902106868 1:14044858-14044880 ATGATGTTATGAGATTTCTGAGG + Intergenic
903096973 1:20985964-20985986 AGAAGGATTTGACATCTGTGTGG - Intronic
903102443 1:21043470-21043492 ATTTTCTTTTGACATTTCTGTGG - Intronic
903102962 1:21049063-21049085 CTAATGTTTTGAATTGTCTGTGG + Intronic
903201315 1:21742001-21742023 TTAATGTTTTGAGATCATTGAGG + Intronic
903707015 1:25293530-25293552 ATAATATTTTGATATGTCTCTGG + Intronic
904995076 1:34625454-34625476 ATAATGTTTTGACATCTTTGGGG + Intergenic
907603755 1:55794982-55795004 ATATTGTTATGGGATCTCTGGGG - Intergenic
907616544 1:55932483-55932505 ATGATATTTTGTCATCTCTGGGG + Intergenic
907778327 1:57541086-57541108 ATAATGTTTGTACATATCTATGG - Intronic
909027994 1:70505197-70505219 ATTATGTTTTAACATCTCAGAGG - Intergenic
909914368 1:81299252-81299274 ATAAAGCTTTTACATCACTGAGG + Intergenic
911288547 1:96028014-96028036 CTAATGTTATGACATCCCTGGGG + Intergenic
911290279 1:96049084-96049106 ATAATGTTTTGCCAGCTATTTGG + Intergenic
912191529 1:107346582-107346604 CACTTGTTTTGACATCTCTGAGG - Intronic
912241473 1:107914641-107914663 ATAATGTTTGGAAAACACTGAGG + Intronic
913321158 1:117589436-117589458 ATAATGTTTTGCCAGCTATCTGG - Intergenic
913668644 1:121073807-121073829 ATAATGTTTTTAAATCCCTGTGG - Intergenic
914020388 1:143861250-143861272 ATAATATTTTTAAATCCCTGTGG - Intergenic
914658888 1:149769162-149769184 ATAATGTTTTTAAATCCCTGTGG - Intergenic
914963995 1:152236664-152236686 ATAATGTTTTACCAGCTATGTGG - Intergenic
916293769 1:163194258-163194280 ATAATGTTTAAAAATCTCAGTGG - Intronic
916673467 1:167045908-167045930 ATAATCTCTTGAAATTTCTGGGG + Intergenic
917136739 1:171795346-171795368 ATTATGTTTTCAGATCTCTTGGG + Intronic
917221629 1:172736357-172736379 ATAATGCTTTCACATATATGAGG + Intergenic
917318020 1:173748599-173748621 ATAAAGATTTGCCATCACTGAGG + Intronic
917704702 1:177620250-177620272 ATAATGTTTTACCAGCTATGAGG + Intergenic
918590967 1:186240691-186240713 ATGATCTTGTCACATCTCTGTGG + Intergenic
918775320 1:188621655-188621677 ATAATGTTTCTTCATATCTGTGG - Intergenic
919181886 1:194096255-194096277 ATAATGTTTTACCAGCTGTGTGG - Intergenic
919447245 1:197722716-197722738 ATAATGTTTTCATTTCTGTGAGG - Intronic
920268394 1:204744152-204744174 ATAATGTTTTGCCAGCTATCTGG + Intergenic
920691433 1:208149929-208149951 TTAATGTTTTCACAGCTCAGAGG - Intronic
921579272 1:216876168-216876190 ATAATATTTTAATCTCTCTGTGG - Intronic
921758603 1:218886386-218886408 ATAATGTTTTGGCTCTTCTGAGG + Intergenic
922495096 1:226050834-226050856 ATACTTTTTTGTCATCTTTGAGG - Intergenic
922938558 1:229440125-229440147 ATGCTGTGTTGACATTTCTGTGG - Intergenic
923414379 1:233740395-233740417 GAAATGTTTTAACATCTCTATGG - Intergenic
923642836 1:235782786-235782808 AAAATGTTATGTCATCTATGAGG + Intronic
923898258 1:238296649-238296671 ATAATTACTTGACCTCTCTGGGG - Intergenic
923914165 1:238483930-238483952 AAAATGTTTGGGTATCTCTGTGG + Intergenic
1063787206 10:9399429-9399451 AGAATGTTTTGCTATCTCTTGGG - Intergenic
1064776227 10:18780525-18780547 ATAATGTTTTGCCAGCTATCTGG + Intergenic
1065571960 10:27080443-27080465 TTAATGTTTTAATATTTCTGGGG - Intronic
1065980142 10:30886947-30886969 ATGATGATTTGACATCTTAGAGG + Intronic
1066164267 10:32769313-32769335 ATAATCTTTTTAAATTTCTGTGG + Intronic
1066486671 10:35852308-35852330 ATGATGTTTTGACCTCTTGGGGG - Intergenic
1066682172 10:37944980-37945002 ATGATGTTTTGACATCTTGCTGG + Intergenic
1067307661 10:45079920-45079942 ATGATGTTTTGACCTCTTGGGGG - Intergenic
1068394985 10:56448649-56448671 ATAATGTTTTATCAGCTATGTGG - Intergenic
1069646256 10:70000323-70000345 ATAATGTTTTGCCAGCTACGTGG + Intergenic
1071904881 10:90161867-90161889 AGAATGTTTTGTCTTCTGTGGGG - Intergenic
1073150259 10:101306531-101306553 ATAAGGTTTTGTCATCTTAGAGG - Intergenic
1075201067 10:120404598-120404620 ATAATGTTTTACCAGCTATGTGG - Intergenic
1075609878 10:123844154-123844176 ATAATTTTGTAACATCTCTGGGG - Intronic
1075984510 10:126772664-126772686 AAAATTTTTTGACTTTTCTGTGG - Intergenic
1076466455 10:130685710-130685732 ATAATGTGTTGACATCAGTAAGG - Intergenic
1076926384 10:133490337-133490359 AGAGTGTTTTCACTTCTCTGTGG + Intergenic
1078386530 11:10898103-10898125 ATAGTGTTTCCTCATCTCTGAGG - Intergenic
1078882002 11:15460865-15460887 AGAATGCTTTGAGATCTTTGTGG + Intergenic
1079733315 11:23962677-23962699 ATTATGTTGTGATATCTCTGGGG - Intergenic
1080784549 11:35462991-35463013 AAATTATTTTGAGATCTCTGAGG - Intronic
1081132992 11:39403265-39403287 ATAATGTATTGACATCAATATGG - Intergenic
1081882358 11:46464609-46464631 ATGATGCTTTGACATCTTAGGGG + Intronic
1081923739 11:46804780-46804802 ATAATCTTTAGACTTCTATGTGG - Intronic
1082935007 11:58647179-58647201 ATAATCTTTTGGGAGCTCTGTGG - Intronic
1086787758 11:90992661-90992683 TTAAGGTGTGGACATCTCTGGGG + Intergenic
1087253553 11:95930241-95930263 AAAATGTTTTGGCTTTTCTGGGG + Intergenic
1087536126 11:99447969-99447991 ATAATGAATTGACATTTATGAGG - Intronic
1089156603 11:116407505-116407527 ATAATGTTTTGCCAGCTCTCTGG - Intergenic
1090981882 11:131729928-131729950 ATAATGTTTTAATTTCTCTCGGG + Intronic
1091053078 11:132392390-132392412 ACAATGTTTTAACCTGTCTGTGG - Intergenic
1092775269 12:11938971-11938993 ATAATGTTTTTACATATCGATGG - Intergenic
1093899088 12:24609071-24609093 AGAATGTTTTAACAGTTCTGAGG - Intergenic
1094690134 12:32760781-32760803 ATAATGTTTTGAGATATTTATGG + Intergenic
1095341026 12:41088395-41088417 ATAATGTTTTGGCAGCTATCTGG + Intergenic
1095424365 12:42059722-42059744 ATAATGTTTTGCCAGCTATCTGG - Intergenic
1095682156 12:44990324-44990346 ATAATGTTTTGTCAGCTATTTGG + Intergenic
1097583810 12:61491205-61491227 CTAATGTTTTCACATCTTGGAGG + Intergenic
1097981908 12:65743952-65743974 ATAATGTAGTGACATCTTTGTGG + Intergenic
1098171256 12:67749502-67749524 ATAATGTTTTGCCAGCTATCTGG - Intergenic
1098178888 12:67824278-67824300 TTAATGATTTGAAATATCTGAGG + Intergenic
1098215693 12:68215380-68215402 AAAATTTTTTCACTTCTCTGAGG + Intronic
1100109996 12:91229237-91229259 ATATTATTTTGACATATCTTAGG - Intergenic
1100182684 12:92102422-92102444 ATATAATTTTGGCATCTCTGTGG - Intronic
1100429455 12:94517542-94517564 ATAATGTTTTGCCACTTCTCTGG + Intergenic
1103424517 12:120820926-120820948 ATAATATTTTGATATTTTTGTGG - Intronic
1104195802 12:126536528-126536550 AAAATGTATTGACTTCTCTATGG + Intergenic
1104557442 12:129814000-129814022 AAAATGTTTAGACCTCACTGAGG + Intronic
1104864700 12:131946045-131946067 ATAATGTTTTCACTGCTCTGTGG + Intergenic
1106842437 13:33698602-33698624 AATATGTTTTGATTTCTCTGAGG + Intergenic
1108231059 13:48341395-48341417 ATAATGTTTTCATTTCTCTTGGG + Intronic
1109925698 13:69135578-69135600 GTTCTGTTTTTACATCTCTGAGG + Intergenic
1110336303 13:74334748-74334770 ATAATATTTTGCTATGTCTGGGG + Intergenic
1110879933 13:80559167-80559189 ATAATCATTTGACTTCTCTTTGG + Intergenic
1111336032 13:86824844-86824866 ATAATCTTATGACATCACTGTGG + Intergenic
1111629662 13:90833797-90833819 AAAATGTTTTAACAGCACTGTGG + Intergenic
1112403082 13:99093048-99093070 AAAATGTTTTGACTTCAGTGTGG - Intergenic
1114540609 14:23454821-23454843 ATGAGGTTTTGACATCTTAGGGG - Intergenic
1115738871 14:36365781-36365803 ATAATTTTTTGACTTCTTTAAGG - Intergenic
1116141958 14:41007767-41007789 AGAATGTTTAAACATATCTGAGG + Intergenic
1119339933 14:73868458-73868480 AGGATGTTTTGACATCTTAGGGG + Intronic
1119618269 14:76112745-76112767 TTAATGTTATGGGATCTCTGGGG - Intergenic
1120313030 14:82855343-82855365 TTAATGTTAGGACATCTCTGGGG + Intergenic
1120351994 14:83373163-83373185 ATAATGTTTTGCCAGCTATCTGG + Intergenic
1124193477 15:27600256-27600278 ATAATATTTGTACATTTCTGTGG - Intergenic
1125233088 15:37480818-37480840 CTACTGTTTTGACATGTCAGAGG - Intergenic
1126132212 15:45352828-45352850 ATGATGTTTTGACATCTTGCTGG - Intergenic
1127666956 15:61157210-61157232 ATTAAGTTTTGACACCTCTTAGG + Intronic
1128267848 15:66282199-66282221 TTAATGCTTTGACAATTCTGGGG - Intergenic
1131500416 15:92958678-92958700 AAAATGTTTTGACTTTTCAGTGG + Intronic
1131612168 15:93976683-93976705 ATAATGTTTTACCAGCTATGTGG + Intergenic
1133203068 16:4216597-4216619 ATAATGTTTTGCTCTTTCTGAGG - Intronic
1133596549 16:7299185-7299207 ATATAGATTTGACATCACTGTGG - Intronic
1133690011 16:8204473-8204495 AAAATGTTTTCACTTTTCTGTGG - Intergenic
1133702345 16:8320694-8320716 ACAATGTTTTGCCAGCTCTCTGG - Intergenic
1137322691 16:47401287-47401309 ATAATGTGTTGAAATATCTGTGG + Intronic
1137450312 16:48567769-48567791 ATGATGTTTTGACATCTTGGGGG + Intronic
1138217547 16:55217806-55217828 ATAATGATTTTATACCTCTGTGG - Intergenic
1138774737 16:59707446-59707468 AGAATGTATTAACATATCTGAGG + Intergenic
1140150852 16:72363508-72363530 ATAATTTGTTAACTTCTCTGTGG - Intergenic
1140259748 16:73367479-73367501 AGAATGTTTTCATGTCTCTGTGG - Intergenic
1140707539 16:77644537-77644559 ATAATGTTTTACCATCTCTCTGG + Intergenic
1143381793 17:6501291-6501313 ATAATGTTTTGACATCTCTGGGG + Intronic
1144389058 17:14776811-14776833 ATAATGGTGTGTCATGTCTGAGG + Intergenic
1144720599 17:17467009-17467031 ATTTTGTTTTGTCATCTGTGTGG + Intergenic
1146195981 17:30813401-30813423 ATTATGTTCTTACATATCTGGGG + Intronic
1148517542 17:48234651-48234673 GTAATGTTCTGAGATCTGTGGGG + Intronic
1148615318 17:48996714-48996736 ATAATGTTTTGAGATCCCCACGG - Intergenic
1149244567 17:54690352-54690374 ATAAAGTTTTGGCTTTTCTGTGG - Intergenic
1149600994 17:57892813-57892835 TAAATGATTTGACAACTCTGCGG - Intronic
1149875286 17:60226342-60226364 AGAATGTTTTTAAATGTCTGTGG - Intronic
1152393770 17:80019150-80019172 AAAATGTTTTGCCAGCACTGAGG + Intronic
1152954813 18:29117-29139 GTTATGTTTTGTCATCTTTGTGG - Intergenic
1153611117 18:6886243-6886265 ATTATGTTCTGGAATCTCTGGGG - Intronic
1154505240 18:15031863-15031885 ATAGTGTTTTGGAATCTTTGTGG - Intergenic
1154975449 18:21453000-21453022 AAAATGTTTTGACTTCTCAATGG + Intronic
1155354619 18:24940284-24940306 ATACTGATTTGACTTCCCTGTGG - Intergenic
1155866147 18:30967500-30967522 GTTATGTTTTGCCATCACTGGGG - Intergenic
1156138251 18:34071501-34071523 ATAATGTTTTGACTTTGCAGAGG + Intronic
1157142129 18:45120188-45120210 AAAATGTTTTAACAGCCCTGAGG - Intergenic
1157540721 18:48503895-48503917 ATAATGTTTTTCCAGCTCTCTGG + Intergenic
1157817510 18:50740878-50740900 ACAATGTTATGTGATCTCTGGGG + Intergenic
1158065162 18:53398329-53398351 AGAATATTTTTACATATCTGTGG + Intronic
1158247101 18:55444771-55444793 ATGAATTTTTGACATGTCTGTGG - Intronic
1159416745 18:68160129-68160151 ATAGTCTTTTGACAACTCAGTGG - Intergenic
1159540057 18:69763543-69763565 GTAATGTTTTGAAAGCCCTGAGG + Intronic
1160353934 18:78210427-78210449 ATTATGTTTATACATCTCTGTGG + Intergenic
1163059107 19:14745282-14745304 GTAATGTTTGTACATCTTTGTGG + Intronic
1167013935 19:46827372-46827394 ATAATGTTTTACCAGCTATGTGG + Intergenic
925497192 2:4465306-4465328 ATATTGTTTTTACAACTATGAGG + Intergenic
925588376 2:5485877-5485899 AAAATATTTAGAAATCTCTGAGG + Intergenic
925623706 2:5820519-5820541 ATAATGGTTGCACAGCTCTGTGG - Intergenic
926361094 2:12088123-12088145 ATAATGTTTTACCAGCTCTCTGG + Intergenic
926875263 2:17469332-17469354 ATGCTGTTTTGACAACTTTGTGG + Intergenic
927165669 2:20318080-20318102 ATTCTGTTTTTACTTCTCTGAGG + Intronic
927220759 2:20706944-20706966 ATGATGCTTTGACATCTTGGAGG + Intronic
927429598 2:23016093-23016115 ATAGTGCTTTGACATCAATGAGG + Intergenic
927604417 2:24473327-24473349 ATAACTTTTTGAGGTCTCTGTGG - Intergenic
928250318 2:29671696-29671718 AGAATATTTTCACTTCTCTGTGG + Intronic
928947381 2:36783604-36783626 AAAATGTTTTAACATCACTATGG + Intronic
930369378 2:50484188-50484210 ATAATATTTTGAAAGCTCTTTGG - Intronic
930897506 2:56463050-56463072 ATAATGTTTTATCAGCTCTCTGG + Intergenic
931333977 2:61320506-61320528 ATAATGTTTTAACATTAATGAGG - Intronic
931490792 2:62744603-62744625 AAAATGTTTAGCCATCTTTGGGG + Intronic
931542113 2:63340707-63340729 AGAATGTTTTCACTTCTCTGTGG + Intronic
932170155 2:69547740-69547762 ATAATATTTTCACATCTCTTGGG - Intronic
932739827 2:74282945-74282967 ATTATGTCTTAACACCTCTGAGG - Intronic
933159408 2:79007572-79007594 ATAATATTATAAAATCTCTGAGG - Intergenic
933473039 2:82751626-82751648 ATAGTTTTTTGTCATGTCTGAGG + Intergenic
933523172 2:83401116-83401138 ATAATTTTATGAGATCTCTTGGG + Intergenic
933995710 2:87668239-87668261 TTAAGGTTGTGGCATCTCTGAGG + Intergenic
935133614 2:100279574-100279596 ATGATATTTTGACATCTCAGGGG + Exonic
936298147 2:111282673-111282695 TTAAGGTTGTGGCATCTCTGAGG - Intergenic
936849774 2:116881796-116881818 ATAATGTTTTGCCAGCTATCTGG + Intergenic
937172254 2:119886219-119886241 AAAATGTTCTCACATCACTGAGG + Intronic
937832939 2:126443797-126443819 ATAATGTTTTGACATTTTAAAGG - Intergenic
938504430 2:131862120-131862142 ATAGTGTTTTGGAATCTTTGTGG - Intergenic
938601095 2:132840082-132840104 ATAATGTCTTGACTTTTCTCTGG + Intronic
938792270 2:134687226-134687248 ATCACGTTTTGGCATTTCTGTGG - Intronic
939932138 2:148248675-148248697 ATAATGATATGACATTCCTGAGG + Intronic
941167759 2:162101806-162101828 ATAATGTTTTACCAGCTATGTGG + Intergenic
941410079 2:165143690-165143712 AATATGTTTTGACATGCCTGAGG - Intronic
941828454 2:169926260-169926282 ATGATGTTTTGACATCTTGAGGG - Intronic
942624118 2:177880958-177880980 ATAATGTTTTGCCAGCTATCTGG - Intronic
942709237 2:178814102-178814124 AGAATTTATTGACATCTCAGAGG - Intronic
943659546 2:190543602-190543624 GTAATTTTTTCACTTCTCTGTGG + Intergenic
943709342 2:191073199-191073221 AGAATGTCTTGAAATCTCTCTGG + Intronic
943820251 2:192313716-192313738 ATAATGTTATGGAATCTTTGGGG + Intergenic
944311400 2:198237535-198237557 ATTATGTTTTGATATCTCCTAGG - Intronic
945175527 2:207039592-207039614 GTAATGTTTTGGCAGCTTTGTGG - Intergenic
948245587 2:236481446-236481468 AGAATTTTTTTACCTCTCTGTGG + Intronic
1168946188 20:1760211-1760233 ATAATGTTTTGCCAGCTATCTGG + Intergenic
1169479788 20:5969177-5969199 ATAATTTTTTGACAACTGTGGGG + Intronic
1169627681 20:7590839-7590861 ATAATGATTTGTCATGTATGTGG - Intergenic
1170618448 20:17973947-17973969 ATAATGTTTTGAAAGCTCCAAGG + Intronic
1171006956 20:21475742-21475764 ATAATGTTTTGCCAGCTATCTGG + Intergenic
1171250341 20:23641403-23641425 CAAATGTTTTGCCTTCTCTGTGG + Intergenic
1174572148 20:51509438-51509460 AGAATGTTCTGAGATCACTGGGG - Intronic
1175694380 20:61090513-61090535 GTAATGATTTTACATTTCTGTGG + Intergenic
1176792608 21:13337210-13337232 ATAGTGTTTTGGAATCTTTGTGG + Intergenic
1177298537 21:19209321-19209343 ATAATGTTTTGCCAGCTCTCTGG + Intergenic
1177628010 21:23689669-23689691 ATAATATTTTGTCATCTATCTGG - Intergenic
1177992008 21:28048114-28048136 ATAGTGTTTTGGAATCTTTGTGG + Intergenic
1178601057 21:33994428-33994450 ATATTGTTTTGCCATCTATAGGG + Intergenic
1178732893 21:35120851-35120873 ATAATCTTTTGGGAGCTCTGTGG + Intronic
1179555845 21:42175381-42175403 AAAATGGTTTGACATTTCTAAGG - Intergenic
1180190203 21:46159270-46159292 ACAATGCTTTGACCTCTCGGGGG + Intergenic
1182057231 22:27369203-27369225 ATAAGGTTTTGACTTCTTTGGGG + Intergenic
1184000441 22:41669383-41669405 CTTATGTTTTGACATCTTGGGGG + Intergenic
1184312483 22:43656531-43656553 ATAATCTTATGGCATCACTGTGG - Intronic
949182720 3:1154196-1154218 ATTATGTTTTGTCAGCACTGGGG + Intronic
949408406 3:3738656-3738678 ATAATGTTTTACCAACTCTATGG - Intronic
949586352 3:5442314-5442336 GTAATTTTTTGAGATCTCTTGGG + Intergenic
950787945 3:15451259-15451281 AGAATGTTTTGATCTCTTTGGGG - Exonic
951060931 3:18206447-18206469 ATAATGAGTTGACTTCTCTTTGG + Intronic
951629419 3:24702858-24702880 ATAAGGTTTTGAGTTCTCTTGGG + Intergenic
952476937 3:33719723-33719745 ATAATGTTTTGCCAGCTATTTGG - Intergenic
952698385 3:36297683-36297705 ATAATGTTTTACCACCTATGTGG - Intergenic
954290917 3:49649588-49649610 ATAGGGTTTGGGCATCTCTGAGG - Intronic
955799989 3:62676721-62676743 ATCATGATTTGATATCTCTATGG - Intronic
958508340 3:95011803-95011825 ATGATGTTTTGACATCTCTTGGG - Intergenic
958816043 3:98916831-98916853 ATAATATTTTGACAGCTGTTGGG - Intergenic
959095585 3:101951947-101951969 CGAATGTTTTTAAATCTCTGGGG + Intergenic
959831155 3:110864185-110864207 ATAATGTTTTACCATCTATCTGG + Intergenic
964297026 3:155245170-155245192 ATAATGTTTTGCCAGCGATGTGG - Intergenic
964566667 3:158063057-158063079 ATAATGTATTGACATTTATATGG - Intergenic
964697971 3:159531081-159531103 ATAAAGTTTTGAAATCTTTTAGG - Intronic
964958565 3:162393809-162393831 ATAATGTTTTACCAGCTTTGTGG - Intergenic
965451418 3:168843444-168843466 AAAATGTTTTGACTTGTATGTGG - Intergenic
965453015 3:168861726-168861748 AAAATGTTTTGCCTACTCTGTGG - Intergenic
965978046 3:174649870-174649892 AAAATCTTTTTATATCTCTGTGG + Intronic
965991590 3:174825576-174825598 ATAATGTTTTGCCAGCTATCTGG + Intronic
966276462 3:178178162-178178184 ATCATGTATTCACATCTGTGTGG - Intergenic
966558145 3:181287026-181287048 AGCATATTTTGAAATCTCTGGGG + Intergenic
967215747 3:187208713-187208735 GCAATGTTTTAACATCTTTGTGG - Intergenic
967674730 3:192283371-192283393 ATAATTTTTTGACATCAGAGAGG + Intronic
970959818 4:21858265-21858287 ATAATGTTATGAGATCCTTGGGG - Intronic
971203978 4:24544345-24544367 ATTATGTTTTTAAATCCCTGAGG - Intronic
971546811 4:27896673-27896695 ATTATGTATTGCCATCTCTAGGG + Intergenic
971640148 4:29120845-29120867 ATAATGATTGAACATTTCTGGGG - Intergenic
972655113 4:41056625-41056647 ATACTGTGTTGACTTCTCTGGGG - Intronic
972846231 4:42993741-42993763 ACAATTTTTTGACTTTTCTGTGG - Intronic
972927045 4:44022506-44022528 CTATTGTTTTGACATCTGGGTGG + Intergenic
973006964 4:45020647-45020669 AAAATCTGTTGACATCTCTAGGG + Intergenic
973161878 4:47029922-47029944 ATAATGTCTTGATATCTCAAAGG + Intronic
976793993 4:88912139-88912161 ATAATGTTTTGCCAACTCTTTGG - Intronic
976834096 4:89350190-89350212 AGAATTTTTTAACTTCTCTGTGG + Intergenic
977322158 4:95531250-95531272 GTAATGTTTAAACATCTCTCTGG + Intronic
978052571 4:104220463-104220485 ATAATGTTTTGCCAGCACTCTGG - Intergenic
978092432 4:104734384-104734406 AAATGGTTTTGACATCTGTGAGG + Intergenic
979357010 4:119716073-119716095 ATAATCTTTTGAGAACTCTATGG + Intergenic
980614509 4:135201245-135201267 ATATGTTTTTGACATATCTGTGG - Intergenic
980805992 4:137814224-137814246 ATAATTTTTTTTCATCTCTATGG + Intergenic
983654815 4:170072000-170072022 ATGATTTTTAGACATCTCTGTGG + Intronic
984406199 4:179333864-179333886 ATATTATTTTGATATCTCTATGG + Intergenic
985393433 4:189515398-189515420 GTCTTGTTTTGACATCTCTCTGG + Intergenic
986117115 5:4786200-4786222 ATCTTGTTTTGAGTTCTCTGAGG - Intergenic
986414255 5:7512302-7512324 ATATTGTTTTGACTTCTGTGTGG + Intronic
986459575 5:7956616-7956638 AAAATTTTTAGACATCTTTGGGG + Intergenic
986552021 5:8967272-8967294 ATGATGTTTTGACATCTTTGGGG - Intergenic
987569408 5:19636658-19636680 ATAATTTTTTGATATCACTATGG + Intronic
987580974 5:19792099-19792121 ATCATGTTTTATCAGCTCTGTGG - Intronic
988173667 5:27692606-27692628 TTAATATTTTAACATATCTGTGG - Intergenic
988226621 5:28420962-28420984 TGAATGTTTTAACATCTCTGGGG - Intergenic
988392371 5:30651675-30651697 TTTGTGTTTTGACATCTCTGTGG - Intergenic
988632552 5:32946491-32946513 ATTATATTTTGATATCTCTCAGG - Intergenic
991123087 5:63038894-63038916 AGAATGTTTAGAAATCACTGGGG - Intergenic
991498981 5:67256999-67257021 ATAATGTTTTACCAGCTCTCTGG - Intergenic
991568746 5:68032479-68032501 AGAAGTTTTTCACATCTCTGCGG + Intergenic
992410287 5:76498830-76498852 ACAATGTTGATACATCTCTGAGG + Intronic
994085479 5:95753775-95753797 GTAATGTTTTGCTTTCTCTGAGG - Intronic
994790704 5:104223065-104223087 ATATTGTTATGAGATCGCTGGGG + Intergenic
994918241 5:106006472-106006494 ATATTGTTTTTACTTTTCTGCGG + Intergenic
994918599 5:106012045-106012067 ATAATGTTTTAACAACTGTGTGG + Intergenic
997139989 5:131368419-131368441 ATACTGTTTTGATATCTGGGAGG + Intronic
997538897 5:134644891-134644913 ATAATTTTTTCATATTTCTGTGG + Intronic
998928613 5:147155803-147155825 ACAAGGGTTTGACTTCTCTGGGG + Intergenic
1000076093 5:157788191-157788213 TTACTGTTTCTACATCTCTGGGG - Intronic
1000674345 5:164102809-164102831 ATAATGTTTTTAGTTTTCTGGGG + Intergenic
1002049174 5:176560068-176560090 ATGATGCTTTGACATCTTTGGGG - Intronic
1002949380 6:1794092-1794114 ATAATGTTTGGATCTATCTGAGG + Intronic
1002988830 6:2218608-2218630 ATAATGTTCTGTACTCTCTGAGG - Intronic
1003332231 6:5139106-5139128 AATAGGTTTTGACATCTCTGCGG + Intronic
1003820394 6:9889925-9889947 ATAATGTTTTGCCAGCTATCAGG - Intronic
1004588872 6:17029717-17029739 ATAATGTTTTACCAGCTCTCTGG - Intergenic
1008422431 6:51317319-51317341 ATAATGTTTTACCAACTCTGTGG + Intergenic
1009799991 6:68524954-68524976 ATTATGTTTTTATATTTCTGTGG + Intergenic
1010337191 6:74700427-74700449 TTAGTGTTTTAACTTCTCTGTGG + Intergenic
1010684964 6:78843456-78843478 TTCATATTTTGACATCGCTGTGG - Intergenic
1010987376 6:82440312-82440334 TTAATGTATTCACATCTCTGAGG - Intergenic
1012846420 6:104395279-104395301 GTAATGTTTTAGCATCTCTCTGG - Intergenic
1012924274 6:105251786-105251808 ATGATGTTTTGACATCTTGGGGG - Intergenic
1013042691 6:106451656-106451678 ATAGTGTATTGACATGACTGTGG + Intergenic
1013470363 6:110458598-110458620 ATAATGTTTTGCCAGCTATCTGG - Intronic
1014186210 6:118436902-118436924 ATAATAATTTTACATATCTGTGG + Intergenic
1014482018 6:121950871-121950893 ATAATGTTTTGGGAGCTCTATGG - Intergenic
1014669057 6:124277140-124277162 ATGTTGTTTTAAGATCTCTGTGG + Intronic
1015696681 6:135988239-135988261 AGAAGGATTTGACGTCTCTGTGG + Intronic
1017092452 6:150772131-150772153 ATAATGTTTTTTGATTTCTGTGG + Intronic
1017195654 6:151697430-151697452 ATAATGTTTTGACGGCTGTCTGG - Intronic
1018694068 6:166376606-166376628 ATAATGTTTTACCATCTATCTGG + Intronic
1020766737 7:12331471-12331493 TTAATGTTTTGATATCCCTCAGG + Intronic
1021079435 7:16346609-16346631 ATAATTTTTTTATTTCTCTGTGG + Intronic
1021566664 7:22023318-22023340 GTAATATATTGGCATCTCTGTGG + Intergenic
1023228090 7:37993139-37993161 AAAATGTTTTGGCCACTCTGAGG - Intronic
1024461789 7:49667016-49667038 ATAATGCATGGACGTCTCTGAGG - Intergenic
1024793891 7:52999937-52999959 ATAATGTTTTAAGAACTCTTAGG + Intergenic
1024951860 7:54869723-54869745 ATAATGCCTTGACATCACTTAGG - Intergenic
1026359527 7:69590925-69590947 ATATTGTTATGGGATCTCTGGGG + Intergenic
1027813830 7:82943352-82943374 AAAATGTTATCACCTCTCTGTGG - Intronic
1028067145 7:86400837-86400859 AGAATGTTATGGCTTCTCTGTGG - Intergenic
1028232545 7:88323095-88323117 TTAATTTTCTGACCTCTCTGAGG + Intergenic
1028443553 7:90892572-90892594 ATATTGATTTGATTTCTCTGTGG - Intronic
1028527680 7:91803452-91803474 TTAAGGTGTTGACATCTTTGAGG + Intronic
1030633974 7:111927068-111927090 ATATAATTTTGACATCACTGAGG + Intronic
1030644977 7:112050448-112050470 ATAATGTTATGTAATCTATGTGG - Intronic
1030932596 7:115543229-115543251 ATATTATTTTGAAATCACTGAGG + Intergenic
1031592542 7:123611158-123611180 ACAATATTTTGACATCTTTAAGG - Intronic
1032741298 7:134742358-134742380 AGAATGCTTTGAGATCTTTGGGG + Intergenic
1034240392 7:149606202-149606224 ATGGTGTTTTGACATTCCTGAGG - Intergenic
1035273659 7:157734561-157734583 AAAATATTTGTACATCTCTGGGG - Intronic
1036951721 8:13146880-13146902 ATAATGCTTTGACATCTGCATGG + Intronic
1037061913 8:14523465-14523487 ATAGTATTTTTACATTTCTGAGG - Intronic
1037135499 8:15455028-15455050 AAGATGTTTTGAGATCTTTGGGG + Intronic
1037208126 8:16350068-16350090 ATAATGTTTTACCATCTATCTGG + Intronic
1037492776 8:19411603-19411625 AAAATGTTTTCACCTCCCTGGGG + Intronic
1038136132 8:24787865-24787887 AGACTATTTTGACATATCTGTGG + Intergenic
1040020767 8:42738999-42739021 ATAATGTTTTCAAAGCTCCGAGG - Intergenic
1040378720 8:46851502-46851524 AAAATATTTTGACATATCTTGGG + Intergenic
1040697129 8:50013626-50013648 ATAATAATTTTACATATCTGTGG + Intronic
1041366618 8:57113002-57113024 ATAATATTGTTACATTTCTGAGG + Intergenic
1041650355 8:60296228-60296250 AAAATTTTGTGGCATCTCTGGGG - Intergenic
1041891868 8:62878333-62878355 CTTATGTTTTGCCTTCTCTGAGG - Intronic
1042474527 8:69232196-69232218 ATATTATTTTGGCTTCTCTGTGG - Intergenic
1043410798 8:79992357-79992379 ATAATGAAAGGACATCTCTGGGG - Intronic
1043503542 8:80879814-80879836 ATGATATTTTCATATCTCTGAGG + Intergenic
1043698881 8:83258125-83258147 ATATTGTTTTGCAAGCTCTGGGG + Intergenic
1044162511 8:88936540-88936562 AGATTGTTTTGACATTTTTGTGG - Intergenic
1044667791 8:94648843-94648865 AGAATATTGTGACATCACTGAGG - Intronic
1045138119 8:99246255-99246277 CTGTTGTTTTGAAATCTCTGAGG + Intronic
1045807228 8:106177696-106177718 ATAACGTTTTTACATTGCTGTGG - Intergenic
1045818686 8:106308427-106308449 ATAATGTTTTGCCAGCTATCTGG + Intronic
1047569395 8:126081704-126081726 ATATTGTTTTGTCATTTCCGAGG - Intergenic
1048634855 8:136284759-136284781 ATAATGTTTTGCCAGCTGTCTGG - Intergenic
1048757161 8:137752568-137752590 ATAATGCTTTGCCATCTATTTGG - Intergenic
1050224068 9:3430823-3430845 TTAATTTTTTGATATTTCTGGGG - Intronic
1050487635 9:6150787-6150809 ATAATGTTTTGCCAGCTATCTGG + Intergenic
1050514666 9:6430450-6430472 ATGATGTTTTGACATCTTTGGGG + Intronic
1051230348 9:14949386-14949408 AAATTGTTGTGACATCTCTCTGG - Intergenic
1051300069 9:15640190-15640212 AAAATGTTTGGACTTCTATGAGG + Intronic
1051417929 9:16862173-16862195 ATAATGTTTTCATTTCTCTTGGG - Intronic
1051766633 9:20531768-20531790 AAAATATTTTTTCATCTCTGAGG + Intronic
1056491312 9:87110162-87110184 ATACTGTTTTCAAATATCTGTGG + Intergenic
1056497298 9:87170842-87170864 ATAATGTTTTGACATCTTTGAGG - Intergenic
1057118449 9:92548105-92548127 ATAGTGGTTTGGCATCCCTGAGG + Intronic
1057458192 9:95233764-95233786 ATGTTGTTTTCACATCTCAGTGG - Intronic
1057520581 9:95756866-95756888 ATAATGTTTTTACATGTATAAGG - Intergenic
1057730485 9:97604184-97604206 ATACTATTTTGAGATATCTGAGG + Intronic
1057750858 9:97791807-97791829 ATAATGTTTTGCCAGCTATCTGG + Intergenic
1058102019 9:100926806-100926828 ATAATGTTTTGCCATCTATCTGG + Intergenic
1058181446 9:101805125-101805147 ATAATGTTTTACCAGCTCTCTGG - Intergenic
1058534034 9:105936589-105936611 ATAATGATTTGTGATCTCTAAGG + Intergenic
1058704928 9:107630216-107630238 AGAATGTTTTGGCGGCTCTGTGG + Intergenic
1060308655 9:122439284-122439306 ATCATGTTTTTACAGTTCTGTGG + Intergenic
1060675341 9:125509236-125509258 ATAATGTTTATATATATCTGTGG - Intronic
1062655486 9:137602569-137602591 ATTATGCTTTGACATCTTGGGGG + Intergenic
1062743039 9:138192155-138192177 GTTATGTTTTGTCATCTTTGTGG + Intergenic
1062743288 9:138194156-138194178 GTTATGTTTTGTCATCTTTGTGG + Intergenic
1062743537 9:138196157-138196179 GTTATGTTTTGTCATCTTTGTGG + Intergenic
1186042271 X:5494033-5494055 ATAATGTTTTACCAGCTCTCTGG - Intergenic
1186757618 X:12689321-12689343 ATATTTATTTTACATCTCTGGGG - Intronic
1186830911 X:13389550-13389572 TTAATGCTTTGACATCTTGGGGG + Intergenic
1186989761 X:15054995-15055017 ATAGTGTTTTGTGTTCTCTGAGG - Intergenic
1187198711 X:17114107-17114129 GTAAGGTTTTCTCATCTCTGAGG + Intronic
1187516379 X:19974955-19974977 CTAATGTTTTTACAGCTTTGAGG - Intergenic
1187885848 X:23887918-23887940 CTAATGTGTTGGCTTCTCTGAGG + Intronic
1190859783 X:54333314-54333336 ACAATCTTTTGAGATTTCTGAGG + Exonic
1190956862 X:55203895-55203917 ATAAAGTCTAGTCATCTCTGTGG + Intronic
1191026544 X:55919809-55919831 ATAATATTTTGGGAGCTCTGTGG + Intergenic
1191563747 X:62497016-62497038 AGAATATTTGGACCTCTCTGAGG - Intergenic
1192003588 X:67184693-67184715 ATAATCTCTTGACATCTCTGAGG - Intergenic
1192025974 X:67452167-67452189 ATAATGTTTTTACATATTTATGG - Intergenic
1192306335 X:69963970-69963992 ATAAAGTTAAGACATCTTTGAGG + Intronic
1192344715 X:70291578-70291600 ATAATAATTAGACATCTCTCAGG - Intronic
1193298991 X:79866787-79866809 ATGATGTTTTGACATCTATCAGG - Intergenic
1193668476 X:84353647-84353669 ATAATGTTTTGCCAGCTATCTGG - Intronic
1194510140 X:94783552-94783574 ATAATCTTTTGAGAGCTCTATGG + Intergenic
1194599708 X:95905051-95905073 ATAATGTTTTAAGAGTTCTGCGG + Intergenic
1195521431 X:105834493-105834515 ATAATGGTTAGAGATCTTTGGGG + Intronic
1196119504 X:112034092-112034114 AGATTGTTTTGACATTTTTGGGG + Intronic
1197323275 X:125060467-125060489 ATAGTGTTTTCAAATCTCTGTGG + Intergenic
1197336530 X:125215913-125215935 AGTATGTTTTGATATCTCTCAGG + Intergenic
1197448203 X:126579011-126579033 ACAATGTTTTAACTTGTCTGTGG + Intergenic
1199556821 X:149118310-149118332 ATAATGTTTTGCCAGCTATCTGG + Intergenic
1200666114 Y:6026613-6026635 GGAATGTTGTGATATCTCTGTGG - Intergenic
1201319272 Y:12679809-12679831 CTAAAGTTTTAACATCTCTGTGG - Intergenic
1201427692 Y:13872269-13872291 ATGATATTTTAAAATCTCTGTGG + Intergenic
1201966000 Y:19736675-19736697 ATATGGTTTTGACATTTCTGGGG + Intronic
1202079820 Y:21072744-21072766 ATAATATTTTGACATATCAGTGG + Intergenic