ID: 1143381793

View in Genome Browser
Species Human (GRCh38)
Location 17:6501291-6501313
Sequence ATAATGTTTTGACATCTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 2, 2: 4, 3: 40, 4: 354}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143381789_1143381793 4 Left 1143381789 17:6501264-6501286 CCCTATATTCATCATGCTTGTTA 0: 1
1: 0
2: 1
3: 9
4: 240
Right 1143381793 17:6501291-6501313 ATAATGTTTTGACATCTCTGGGG 0: 1
1: 2
2: 4
3: 40
4: 354
1143381790_1143381793 3 Left 1143381790 17:6501265-6501287 CCTATATTCATCATGCTTGTTAT 0: 1
1: 0
2: 1
3: 29
4: 272
Right 1143381793 17:6501291-6501313 ATAATGTTTTGACATCTCTGGGG 0: 1
1: 2
2: 4
3: 40
4: 354
1143381788_1143381793 5 Left 1143381788 17:6501263-6501285 CCCCTATATTCATCATGCTTGTT 0: 1
1: 0
2: 2
3: 38
4: 222
Right 1143381793 17:6501291-6501313 ATAATGTTTTGACATCTCTGGGG 0: 1
1: 2
2: 4
3: 40
4: 354
1143381787_1143381793 24 Left 1143381787 17:6501244-6501266 CCTGGGGAATGGGGTGACACCCC 0: 1
1: 0
2: 8
3: 289
4: 4592
Right 1143381793 17:6501291-6501313 ATAATGTTTTGACATCTCTGGGG 0: 1
1: 2
2: 4
3: 40
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143381793 Original CRISPR ATAATGTTTTGACATCTCTG GGG Intronic