ID: 1143385553

View in Genome Browser
Species Human (GRCh38)
Location 17:6527992-6528014
Sequence CAAAAGCCAAAGATGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 517
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 480}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143385553 Original CRISPR CAAAAGCCAAAGATGGAGCA GGG (reversed) Intronic
900742852 1:4341251-4341273 CCAAAGCCAAAGTGGGAGGATGG - Intergenic
902137520 1:14322953-14322975 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
902279330 1:15362822-15362844 CAGAAGCCAAACAAGGAGCCGGG + Intronic
902279346 1:15362904-15362926 CAGAAGCCAAACAAGGAGCCAGG + Intronic
903439868 1:23379609-23379631 AAAAAGTCAAAGATGGGGCCGGG + Intergenic
903830932 1:26174086-26174108 CAAAAGACAAAGCTGGAGACGGG + Intergenic
904548959 1:31299088-31299110 CAAAAGCCAGATATGAGGCAAGG + Intronic
904771559 1:32884159-32884181 CAACAGCCAAAGAAGGTTCAGGG - Intergenic
905305323 1:37013860-37013882 CCCAAGACAAAGTTGGAGCAGGG + Intronic
906893553 1:49744336-49744358 CAAAAGGCAAATGGGGAGCAAGG - Intronic
908171280 1:61507288-61507310 CTGAAGCCAAAGATGCAGAATGG - Intergenic
908342201 1:63193117-63193139 CAAAAGGCAAAGCTGAAGCGAGG + Intergenic
908851246 1:68378570-68378592 CAGAAACCAAAGACAGAGCAGGG + Intergenic
909275660 1:73683253-73683275 CAAAAGCCAAAATTGGCGAATGG - Intergenic
910203672 1:84725829-84725851 CACATGCCAAAGAAGGAGTAGGG - Intergenic
911563840 1:99439100-99439122 CAGAAGCCAAATATAGAGAAGGG - Intergenic
911630212 1:100174995-100175017 CAGGAGCAAAAGAGGGAGCAGGG - Intronic
911957070 1:104250880-104250902 CAAAAGTGAAAAATGGATCATGG + Intergenic
912059163 1:105642938-105642960 CAAAGGTCAAAGATAGAGAAAGG + Intergenic
913316977 1:117561769-117561791 CAGAAGCCAAAGATGGAGGATGG + Intergenic
913591916 1:120337485-120337507 CCAAAGCCAAGGAGAGAGCAAGG - Intergenic
913651440 1:120917661-120917683 CCAAAGCCAAGGAGAGAGCAAGG + Intergenic
914169669 1:145211410-145211432 CCAAAGCCAAGGAGAGAGCAAGG - Intergenic
914524783 1:148455372-148455394 CCAAAGCCAAGGAGAGAGCAAGG - Intergenic
914598892 1:149180461-149180483 CCAAAGCCAAGGAGAGAGCAAGG + Intergenic
914641618 1:149611762-149611784 CCAAAGCCAAGGAGAGAGCAAGG + Intergenic
915438653 1:155929295-155929317 AAAAAGCCAAAGTGGGACCAGGG - Exonic
916078876 1:161219627-161219649 GAAAAGCCAAATATGCAGAACGG + Intronic
918411914 1:184268216-184268238 CAATTGCCTAAGATGGTGCATGG - Intergenic
918870098 1:189960677-189960699 CAAAAGCCATAGATGCAGGTAGG - Intergenic
918913466 1:190604369-190604391 CAGAAGCCAAAGGGGAAGCAGGG - Intergenic
919040047 1:192374581-192374603 CAAAAACCAGAGATGAATCAAGG + Intergenic
919463380 1:197904268-197904290 CCACAGACAAAGATGAAGCAAGG - Intronic
920166465 1:204039715-204039737 CGGAAGCCAAAGTGGGAGCAAGG - Intergenic
920549842 1:206849144-206849166 CAAAAGTCAAAGATAAAGAAAGG + Intergenic
920984445 1:210872610-210872632 CAAAAGGTAAAGGGGGAGCAAGG + Intronic
921828888 1:219704701-219704723 CCAAAGCCTAATCTGGAGCAAGG + Intronic
922392382 1:225158328-225158350 GAAAATCCAGAGATGGGGCAGGG + Intronic
922569840 1:226627946-226627968 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
922610525 1:226923781-226923803 CACAGTCCAAAGAGGGAGCAGGG + Intronic
922852577 1:228746504-228746526 CACAAGCCAAAATGGGAGCAAGG + Exonic
923396333 1:233568735-233568757 TAAAAGACAAAGATGCAGCCAGG - Intergenic
924270048 1:242322746-242322768 CAAAAGGCAAAGGGGAAGCAAGG - Intronic
1062941472 10:1424676-1424698 TAAAAGGCACAGATGGGGCATGG + Intronic
1063041472 10:2342735-2342757 CAGAAGCCAAACAAGGAGCTAGG + Intergenic
1063278458 10:4597726-4597748 CCCAAGCCAGAGATGCAGCAGGG + Intergenic
1063874753 10:10462456-10462478 AAAAAGGCAAAGAAGAAGCAGGG - Intergenic
1066718654 10:38313937-38313959 CAAAAGCCAGGCATGGACCATGG + Intergenic
1067783570 10:49226714-49226736 CAAAAAGCAAAGATGGGGCAAGG + Intergenic
1068314755 10:55325450-55325472 CAAAAACAAAAGATGGGGAAAGG + Intronic
1069645772 10:69995862-69995884 TAAAAATCAATGATGGAGCAGGG + Intergenic
1070388258 10:75946609-75946631 CCAAAGCCCAAGAAGGAGCTAGG - Intronic
1070428533 10:76313415-76313437 CAATTGCCCAAGATGGAGCCTGG + Intronic
1070896533 10:79987223-79987245 CAAATGTCAAAGATGAAGAAAGG + Intergenic
1072919436 10:99563556-99563578 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1073864392 10:107785134-107785156 GAAAAGCCAAAGAAGGGACAAGG - Intergenic
1073951481 10:108814236-108814258 CAGAAGTCAAAAATGCAGCAGGG - Intergenic
1074594831 10:114852574-114852596 CAAAAAGCAAAAATGGAGAAGGG - Intronic
1075493381 10:122894557-122894579 CAAAACCAAAAGAGGCAGCAAGG + Intergenic
1076210361 10:128636717-128636739 CAGAAGACAAAGAGGAAGCAAGG - Intergenic
1076326528 10:129627684-129627706 CAAGAGCCAAATATGAAGCATGG - Intronic
1076524944 10:131106538-131106560 CAAGAGCCAATGAAGGTGCAGGG + Intronic
1076931615 10:133535452-133535474 CAAAGGCCAGGGATGGGGCACGG - Intronic
1078467679 11:11562239-11562261 CAGAAGCCAAAGAGAGAGCCTGG - Intronic
1078674195 11:13394403-13394425 CAGAAGGCAAAGAGGAAGCAAGG - Intronic
1079416311 11:20239242-20239264 CCACTGCCAAAGATGGAGGAGGG + Intergenic
1079546709 11:21642164-21642186 CAAAAGGCAAAGAAGGAGCGAGG - Intergenic
1080792057 11:35530195-35530217 CCAAGGCCAGAGATGGAGAAGGG + Intronic
1081045311 11:38266905-38266927 CAAAAGGCAAAGCAGAAGCAAGG - Intergenic
1081622185 11:44625107-44625129 CAGCAGGCAAAGAGGGAGCAGGG + Intergenic
1082867018 11:57909531-57909553 CAAAAACAAATGATGGAGAAAGG - Intergenic
1084005651 11:66322208-66322230 CAAAAACCAAAGACAGGGCAGGG + Intergenic
1084251023 11:67899257-67899279 CAAAAGCCAAAGTTGAAAAATGG + Intergenic
1085150749 11:74251288-74251310 CAAAAGCCAGAGATGGAAGAGGG + Intronic
1087326394 11:96728158-96728180 CAAAAGCCAAAAATAGACTACGG + Intergenic
1087596606 11:100261927-100261949 CAAAAGCCAAAATTGGAAAATGG + Intronic
1087817909 11:102679334-102679356 CAGAAGGCAAAGGGGGAGCAGGG + Intergenic
1088013919 11:105036622-105036644 CAAAAGGCAAAAGAGGAGCAAGG - Intergenic
1088415223 11:109581234-109581256 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1089316483 11:117594653-117594675 CCAAAGCCAGAGGAGGAGCAGGG - Intronic
1089849585 11:121484750-121484772 CAAAAACAAAAGAAGAAGCATGG - Intronic
1089890340 11:121874485-121874507 CAAATGCCACAGAGCGAGCAGGG + Intergenic
1090087107 11:123660105-123660127 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1090306959 11:125699487-125699509 CAGAAGGCAAAGGGGGAGCAGGG - Intergenic
1090307118 11:125701045-125701067 AAAAAACCACAGATGGATCATGG + Intergenic
1090316586 11:125796121-125796143 CAAAGGCCAAGGATAAAGCATGG - Intergenic
1090714229 11:129416032-129416054 TAAAAGTCAAAGATGAAACAGGG - Intronic
1090751090 11:129747137-129747159 CAAAAGCTAAAGCTAGAGCCAGG + Intergenic
1091168047 11:133497980-133498002 CAAAAGCAGAGGATGGAGCCTGG - Intronic
1091490921 12:931959-931981 CTAAAGACAAAGATGGAGTTTGG + Intronic
1091925626 12:4345738-4345760 CAAAAGCCAAAGTTGACGAATGG + Intronic
1092206400 12:6616822-6616844 GAAAATCCAAAGATAGAGAAGGG - Intergenic
1092219242 12:6701328-6701350 GATAATCCAAAGATGGTGCAAGG - Intergenic
1092310136 12:7343566-7343588 CAAAAGCAAAAGAGAGAGCAGGG + Intergenic
1092510976 12:9156359-9156381 CAAGATCCAGAGATGGAGGAAGG - Intronic
1093931398 12:24957994-24958016 CAAAAACCAAATATTGAGGATGG + Intergenic
1094297146 12:28919909-28919931 CAGAAGCCAAAGGGGAAGCAAGG + Intergenic
1095226586 12:39685358-39685380 CAGAAGGCAAAGGGGGAGCAAGG + Intronic
1095731400 12:45510615-45510637 CAAAAGGCAAAGGGGAAGCAAGG + Intergenic
1095872728 12:47048425-47048447 CAGAAGGCAAAGGAGGAGCAAGG + Intergenic
1096292934 12:50357581-50357603 CAAAAGGCAAAGATAAAACAGGG + Intronic
1097105826 12:56623708-56623730 CAGAAGCCAAAGATGCTGCTAGG + Intronic
1097371866 12:58793069-58793091 AAAAAGCAAAAGACAGAGCATGG - Intronic
1097786471 12:63765502-63765524 CAAAAGCCAGAGAGGGAGGGGGG - Intergenic
1097786738 12:63768561-63768583 CAAAAACAAAAGAAAGAGCAAGG + Intergenic
1099314067 12:81063101-81063123 CAGAAGGCAAAGAGGAAGCAAGG + Intronic
1100019943 12:90057152-90057174 CATAAGACAAAGTTGGACCAAGG - Intergenic
1100117416 12:91324325-91324347 CAAAAGCCTAATCTAGAGCAAGG - Intergenic
1101963333 12:109265801-109265823 CCAAAGTCACAGCTGGAGCAGGG + Intronic
1102341797 12:112127177-112127199 GAAAAGACAAAGATAGAGGATGG - Intronic
1104221443 12:126788452-126788474 CAGAGGCCAAACAAGGAGCAGGG + Intergenic
1104330806 12:127842964-127842986 GAAAAGAAAAAGATGGATCAAGG - Intergenic
1104497218 12:129252202-129252224 TAAAACCAAAAGATGGAGCTGGG + Intronic
1104509418 12:129363044-129363066 CAATAAACAAAGATGGAGGAAGG - Intronic
1104644170 12:130485352-130485374 TAAAAGCCACAGCTGGAACATGG + Intronic
1104853980 12:131893775-131893797 TAAAAGCAAAATATGGAACAGGG - Intergenic
1105529081 13:21201940-21201962 CAGAAGGCAAAGAGGAAGCAGGG + Intergenic
1106910341 13:34456422-34456444 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
1107380230 13:39849284-39849306 CAAAAGCCAAAGTAGGAAAATGG - Intergenic
1107462412 13:40616845-40616867 CAAAAGGGACAGATGGAGAAAGG + Intronic
1107689577 13:42939152-42939174 CCAAAGCCTAAGCTAGAGCAAGG - Intronic
1108281384 13:48865573-48865595 CAAATGCCACAGATGGGTCATGG + Intergenic
1108606479 13:52044667-52044689 CCAAAGCCCAAGATAGAGAAGGG + Intronic
1108878947 13:55085629-55085651 CAAAGGCCAAAGATAAAGAATGG - Intergenic
1109864368 13:68243539-68243561 GAAAAGCCAAGGATAGAGAAAGG - Intergenic
1109880767 13:68471736-68471758 CAGAAGGCAAAGATGGACAAAGG - Intergenic
1109888507 13:68575450-68575472 CAGAAACAAAAGATGGAGAAGGG - Intergenic
1110656899 13:78011117-78011139 CCAAAGCCAATCATGGAGGATGG + Intergenic
1111443072 13:88305452-88305474 CCAAAGGCAAAGAGGGAACAAGG - Intergenic
1114261452 14:21039529-21039551 CAACAGAAAAAGATGGAGGAAGG - Intronic
1114521320 14:23338992-23339014 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1114625631 14:24127859-24127881 CCAAAGCCTAATCTGGAGCAAGG - Intronic
1114688921 14:24562268-24562290 CAGAAGGCAAACAGGGAGCAAGG - Intergenic
1115669378 14:35591969-35591991 CAAAAGGCAAAGGGGAAGCAAGG - Intronic
1116115842 14:40649651-40649673 CACAAGCCAGAGATAAAGCATGG + Intergenic
1116326851 14:43540989-43541011 CCAGAGCCAAAGCTGGAGCCCGG + Intergenic
1116603337 14:46956958-46956980 CAAAAGGCAAAGGGGAAGCAAGG - Intronic
1117581177 14:57153267-57153289 CAAAAGCCAGAGATGTAGATGGG + Intergenic
1117838897 14:59836726-59836748 CAACAGGCAAAGATGGGTCAAGG + Intronic
1118286452 14:64478456-64478478 CAAAAGGCAAGAAAGGAGCAAGG + Exonic
1119933193 14:78567426-78567448 GAAGATCCAGAGATGGAGCAGGG - Intronic
1120257739 14:82141455-82141477 CAAAAGGCAAAGAGAAAGCAAGG + Intergenic
1120724425 14:87922016-87922038 CAGAAGGCAAAGGTGAAGCAAGG - Intronic
1120906677 14:89626750-89626772 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
1121500415 14:94431453-94431475 CAGAAGGCAAAGGGGGAGCAAGG - Intergenic
1121883896 14:97525174-97525196 TAAAAGTGAAAGAAGGAGCAAGG - Intergenic
1123430450 15:20211155-20211177 CAAAAGCCAAAGGTGAATCCTGG + Intergenic
1125274571 15:37977597-37977619 CAAAGCACAGAGATGGAGCATGG - Intergenic
1125278418 15:38017980-38018002 CAAAAGGCAAAGGGGAAGCAAGG - Intergenic
1126255589 15:46621689-46621711 AAAAAGCCCAAGAGGAAGCATGG + Intergenic
1126570406 15:50144450-50144472 CAGAAGGCAAAGAGGAAGCAAGG + Intronic
1127527510 15:59808217-59808239 CAAAAGCAAGAAATGGAGAAAGG + Intergenic
1127629803 15:60817562-60817584 CAAAAGCCCAGGATGGAGACAGG - Intronic
1129009833 15:72405520-72405542 CTAGAGCCAAAGATGGAAGAAGG + Intronic
1129160875 15:73747035-73747057 GAAAGGTCAAAGAGGGAGCAGGG - Intronic
1129910430 15:79221767-79221789 CAGAAGCCCATGATGGGGCAGGG + Intergenic
1129921522 15:79323114-79323136 CAGAAGGAAATGATGGAGCAGGG - Intronic
1130067056 15:80613664-80613686 AAAAAGCCAAACTTGGAGGACGG + Intergenic
1130119113 15:81031512-81031534 CAGAAGTCAAAGGAGGAGCAGGG - Intronic
1131541580 15:93279541-93279563 CAGGAGCCAAAGCTGGAGCCTGG + Intergenic
1131773332 15:95765211-95765233 CAGAAGGCAAAGAAGAAGCAAGG + Intergenic
1132984579 16:2757996-2758018 AAAAAGACAAAAATAGAGCATGG - Intronic
1133437199 16:5790096-5790118 CAAATGCTGAAGATGGAGGAAGG - Intergenic
1134332456 16:13263502-13263524 CAGAAGGCAAAGAGGTAGCAGGG - Intergenic
1134694367 16:16212250-16212272 CAACAGACAAAAATGGAGAAGGG + Intronic
1134977466 16:18582380-18582402 CAACAGACAAAAATGGAGAAGGG - Intergenic
1135331950 16:21567763-21567785 TAAAAGCCACAGCTGGAGCCAGG - Intergenic
1135488744 16:22888678-22888700 GAAAAGCCAGAGACGGAGCCAGG - Intronic
1135850784 16:25961356-25961378 CAAATGCCAAAGATGCAATAAGG - Intronic
1135862764 16:26072011-26072033 CAAAATCCAAAGATAGGGAAAGG - Intronic
1136065452 16:27755323-27755345 CAGAAGGCAGAGATGGAGCAGGG - Intronic
1136679389 16:31947366-31947388 CAAAAGTCAAAGATATAGAAAGG + Intergenic
1136854183 16:33640055-33640077 CAAAAGCCAAAGGTGAATCCTGG - Intergenic
1136867704 16:33770078-33770100 AAAAAGCCAAATATGGGGCCAGG + Intergenic
1137700413 16:50493921-50493943 CAGAAGCCAGGGATGGAGCCTGG + Intergenic
1137840056 16:51632474-51632496 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1139127420 16:64095947-64095969 CAAAAGCATTAGATGAAGCAGGG + Intergenic
1140668272 16:77248066-77248088 CTAAAGTCCAAGAGGGAGCAAGG + Intronic
1141371355 16:83489088-83489110 CACAAGAAAAAGATGAAGCATGG + Intronic
1141856987 16:86689631-86689653 CCAAAGCCTAATCTGGAGCAAGG - Intergenic
1141882891 16:86871658-86871680 CAGAAGGCAAAGAAGAAGCAAGG - Intergenic
1203104455 16_KI270728v1_random:1346125-1346147 AAAAAGCCAAATATGGGGCCAGG - Intergenic
1203115758 16_KI270728v1_random:1488508-1488530 CAAAAGCCAAAGGTGAATCCTGG - Intergenic
1203129059 16_KI270728v1_random:1616243-1616265 AAAAAGCCAAATATGGGGCCAGG + Intergenic
1143385553 17:6527992-6528014 CAAAAGCCAAAGATGGAGCAGGG - Intronic
1144864997 17:18329846-18329868 CAAAAACAAAAAATGGAGCGGGG - Intronic
1146453778 17:32994368-32994390 CCAAAATCAGAGATGGAGCAAGG + Intronic
1146681131 17:34809154-34809176 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
1148218372 17:45846224-45846246 CCGAAGCCAAGGATGGAGAAGGG - Exonic
1149704953 17:58686581-58686603 GAAAAGCCAAATATGTAGAAAGG + Intronic
1150011476 17:61508594-61508616 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1150753686 17:67890465-67890487 TAAAATCCAGAGATGGAGAAGGG - Intronic
1150775347 17:68077139-68077161 CAAAACCCAAAAAAGTAGCAAGG + Intergenic
1150843919 17:68635402-68635424 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
1151278834 17:73056494-73056516 CAAAAGCCAAAAAAAGATCAGGG - Intronic
1151607531 17:75148459-75148481 CAACAGCCACAGATGCAGCTTGG - Intronic
1151942196 17:77299891-77299913 CAAAAGCCAAAGAAGGCCCATGG - Intronic
1152342299 17:79731800-79731822 AAAAAGCCAAATATGGGGCCAGG + Intronic
1153311898 18:3685264-3685286 AAAAATCCAAAGATGGGGCCTGG + Intronic
1154127779 18:11707964-11707986 CCAAAGCCTAAGTTGGAACAAGG - Intronic
1155356932 18:24961977-24961999 CAAAGGCTAAAGATGGAAGAAGG + Intergenic
1157121205 18:44912981-44913003 TAAAAGCCAAAGCTGGAGGGAGG - Intronic
1157969268 18:52247662-52247684 GAAAAGCCAATGACTGAGCAAGG + Intergenic
1158358980 18:56650890-56650912 GAAATGCCAAATAAGGAGCAAGG - Intronic
1159265630 18:66074762-66074784 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1159403187 18:67963735-67963757 CATAAGCCAATGATGGAGCCAGG - Intergenic
1159581792 18:70241560-70241582 CAAAAGCCAAAAATGAAAAATGG + Intergenic
1161232352 19:3180593-3180615 CAGAGGCCAGAGATGGGGCATGG - Intergenic
1161662524 19:5555731-5555753 CAAAAGCCACAGAAGCTGCAGGG - Intergenic
1164437536 19:28244368-28244390 GAAAAGCCTAAGATGAAGCAAGG - Intergenic
1164583460 19:29449839-29449861 TAAAAGCCAAACATGGTGCCGGG + Intergenic
1166488194 19:43232576-43232598 CAAAAGGCACAGCTGGAGGATGG - Intronic
1166494861 19:43293056-43293078 CAAAAGGCACAGCTGGAGGATGG - Intergenic
1166681194 19:44768177-44768199 CAGACTCCAAAGATGGAGGAAGG + Intergenic
1167512870 19:49905572-49905594 CCAGAGCCCAAGATGGTGCAAGG + Intronic
1167736929 19:51300491-51300513 TAAAAGCCAAAGATGGTGCTAGG + Intergenic
1167772328 19:51529137-51529159 CAGAAGCCAGGGAAGGAGCATGG + Intronic
924978705 2:200746-200768 CAAACGCCAGAGCTGGAGCTCGG - Intergenic
925205547 2:2002908-2002930 CAGAAGGTAAAGAAGGAGCAAGG - Intronic
927305100 2:21562240-21562262 GAGAAGCCAGAGATGGAGGAAGG + Intergenic
927381986 2:22489800-22489822 TTAAAGTCAAAGATGGAGAAGGG + Intergenic
928410131 2:31048306-31048328 CAAAAGCCACAGAGCCAGCAGGG - Intronic
928415175 2:31085889-31085911 CAGAAGGCAAAGGAGGAGCAAGG + Intronic
928952036 2:36821790-36821812 TTAAAGCCAAAGAGGGAACAGGG + Intergenic
929040158 2:37736890-37736912 CAAAAGGCAAAGGGGAAGCAGGG + Intronic
929371994 2:41236706-41236728 CAATAGCCAAAGGAGGAGCAAGG + Intergenic
929779081 2:44946262-44946284 AAAAAGGCAAAGATGGTTCAAGG + Intergenic
930623627 2:53670656-53670678 CAAACGACAAAGATGGGTCAGGG + Exonic
930939492 2:56997401-56997423 CAAAAGTCAGGGATGGAACAGGG + Intergenic
932163593 2:69485591-69485613 CAAAAGGCATAGATGTGGCAGGG - Intronic
932534069 2:72573077-72573099 GACAAGGCAAAGAAGGAGCATGG + Intronic
932865996 2:75343813-75343835 CAGATTCAAAAGATGGAGCAAGG - Intergenic
933226962 2:79760944-79760966 CAAAAGCCAAATATATGGCATGG + Intronic
934634891 2:95975756-95975778 CAAAAGCCAAATATGACACATGG + Intronic
936818098 2:116484804-116484826 CAAGTGCCAAAGATGGTGAATGG - Intergenic
936869185 2:117112393-117112415 CAATATCCAAAGCAGGAGCATGG - Intergenic
937045825 2:118851015-118851037 CAAATGCCAAAGTTGGGGGAGGG + Intergenic
937298575 2:120824563-120824585 TTACAGCCAGAGATGGAGCAGGG - Intronic
937323729 2:120976496-120976518 AACAAGCCCTAGATGGAGCAGGG + Intronic
937486570 2:122321530-122321552 CATATGCCATAGATTGAGCAAGG + Intergenic
937950441 2:127383026-127383048 CATAAGGCAAAGTGGGAGCAAGG + Intronic
938232359 2:129672212-129672234 CAATATCCAATGATGGAACAGGG - Intergenic
938546999 2:132343093-132343115 TCACAGCCAAAAATGGAGCATGG + Intergenic
938581913 2:132654144-132654166 CACTAGCCAAAGATGGGGGAAGG + Intronic
939071872 2:137553914-137553936 CAAAAGTCAAAAAAGCAGCAGGG - Intronic
939352009 2:141050761-141050783 CAAAAGCCAAAGTTGGCAAATGG + Intronic
939381802 2:141446231-141446253 CAAAAGCAAAAAAAAGAGCAGGG - Intronic
940149865 2:150587992-150588014 CAAAGGCCAAAAGTGGAGAATGG - Intergenic
940786172 2:157983681-157983703 CAAAGGTCAAAGATGAAGAAAGG - Intronic
940956165 2:159730195-159730217 CAAAAGCCAAAGAACTAGCCAGG - Intronic
941035469 2:160563926-160563948 CAAAAACCTAAGATGGAGAAAGG + Intergenic
941361071 2:164551979-164552001 CAGAAGACAAAGCGGGAGCAGGG + Intronic
941420488 2:165278368-165278390 CAAAAGGCAAAGAGGAGGCAAGG + Intronic
941984108 2:171492473-171492495 AAAAAAAAAAAGATGGAGCACGG + Intergenic
942123092 2:172797976-172797998 CAAGATACAAAGATGGAGAAAGG - Intronic
942615205 2:177784744-177784766 CATAAGCCAAAGATGTCACAGGG - Intronic
943082452 2:183271496-183271518 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
943237505 2:185340971-185340993 CAAAAGCCAAAGGCTAAGCAAGG + Intergenic
943990429 2:194682870-194682892 GAAAAGGTAAAGATGGAGAAAGG + Intergenic
944691097 2:202159191-202159213 CATCATCCAAAGATGGAGCAGGG + Intronic
944873719 2:203940249-203940271 CAAAACCCACGTATGGAGCAGGG - Intronic
945072200 2:206003292-206003314 CAAAAGCAAAAGATGGATCAAGG + Exonic
947236685 2:227948789-227948811 CAGAAGGCAAAGAAGAAGCAAGG - Intergenic
948039244 2:234886362-234886384 CCAAAGCCAGAGAAGAAGCAGGG + Intergenic
948502903 2:238408041-238408063 CACAAGAAAAAGCTGGAGCAGGG + Intergenic
1169873508 20:10271933-10271955 CAAAATATAAAGATGGAGCGTGG + Intronic
1169923444 20:10758761-10758783 CAAAAGCCAACCCTGAAGCAAGG - Intergenic
1170445763 20:16425935-16425957 CAGAAGGCAAAGAGGAAGCAAGG + Intronic
1170875800 20:20248875-20248897 CAAAAAGCAAAAATGGAGGACGG - Intronic
1171727362 20:28637296-28637318 CAAATGCCCAGGATGCAGCATGG - Intergenic
1171728131 20:28646470-28646492 CAAATGCCCAGGATGCAGCATGG + Intergenic
1173466805 20:43289766-43289788 AAAATGCCAAAGAAGGAGAAAGG - Intergenic
1173491268 20:43484328-43484350 CAAGAGGCAAAGATGGACCAGGG + Intergenic
1174302097 20:49589834-49589856 AAAAAGTCAGAGAGGGAGCAGGG - Intergenic
1175412130 20:58777337-58777359 TAAAAGACCAGGATGGAGCAGGG + Intergenic
1175783475 20:61697956-61697978 CAGAAGTCAGAGATGGAGCCAGG + Intronic
1175864731 20:62169204-62169226 CCAAAGCCAAGTATGGAGCTGGG + Intronic
1177742553 21:25171257-25171279 CAAGAGCCAAAGATAGAATAAGG + Intergenic
1177804861 21:25865043-25865065 CAAAAGCCAAAGTTTTAGCCTGG + Intergenic
1177853647 21:26377670-26377692 AACAGGCCAAAGATGGAGGAAGG - Intergenic
1178088799 21:29139878-29139900 AAAAAGCCAGAGATGGGGCCTGG - Intronic
1178094162 21:29196566-29196588 CACAAGAGGAAGATGGAGCAGGG - Intronic
1178570216 21:33728888-33728910 CAAAAACCAATTATGGGGCAGGG - Intronic
1179055880 21:37933642-37933664 CAAAAGGCAAAGGGGAAGCAAGG - Intergenic
1180234615 21:46450305-46450327 CAGAAGACAAAGGGGGAGCAAGG - Intergenic
1180393378 22:12305501-12305523 TAAAAGCAAAAGATGGAGGCAGG - Intergenic
1181081114 22:20416115-20416137 CAAAAGCCAAAATTGACGCATGG - Intergenic
1182294324 22:29304312-29304334 CAAAACCCCAAAATGCAGCAAGG + Intergenic
1183412342 22:37662320-37662342 CCAAAGGCAAAGATGGGGAAGGG - Intronic
1184615724 22:45637020-45637042 CAGAAGACAGAGGTGGAGCAGGG - Intergenic
1184681362 22:46073912-46073934 TAAAAGCCCAAAATGGAGCGAGG - Intronic
1184808415 22:46811781-46811803 GAAAAGCCAAAAATGCAGCTGGG + Intronic
1184984503 22:48120346-48120368 GGAAAGCAAAAGATGGAGCTGGG - Intergenic
1185331635 22:50254651-50254673 CAAAAAACAAAAATGGGGCAAGG + Intronic
949240020 3:1859703-1859725 CAAAAGGCAAAGGAGAAGCAAGG - Intergenic
949768368 3:7551921-7551943 CAAATGGCAAAGAGGAAGCAAGG + Intronic
949805382 3:7949950-7949972 CAAAAATAAAAGATGAAGCAAGG + Intergenic
950024532 3:9811070-9811092 CAGCAGCCAAAGAGGGAGAAAGG - Intronic
950128869 3:10528086-10528108 CAAAAGCCCAAGAAGAAGCCAGG - Intronic
950741405 3:15055037-15055059 CAGAAGGCAAAGGGGGAGCAAGG + Intronic
952611492 3:35215817-35215839 CCAGAGCCAAAGCTGGAGCCTGG + Intergenic
952692522 3:36226585-36226607 CAAAAACCAGAAATGGAGAAAGG + Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953760065 3:45679637-45679659 CAAAGGCCTAAGATGGAGGCTGG - Exonic
953824728 3:46241197-46241219 CAAAAGACAAAGAAAGAGGAAGG - Intronic
954196387 3:48999517-48999539 CAGAAGGCAGTGATGGAGCAGGG - Intronic
954884394 3:53859114-53859136 AAAAAGCCAAAGATGTAAGATGG + Intronic
954944633 3:54409753-54409775 CCAAAGCCTAATTTGGAGCAAGG + Intronic
955160690 3:56462908-56462930 CAAATGGCAAAGCTGGAGCCTGG - Intronic
956601250 3:71025150-71025172 GACAAGCCAAAAATGGAGAATGG + Intronic
956969701 3:74508262-74508284 CAGAAGGCAAAGAAGCAGCAAGG - Intronic
957157318 3:76561583-76561605 CAAAAGGCAAAGATAGAACAAGG + Intronic
957364034 3:79198297-79198319 CAAAAACAAAAAATGGAGAAAGG - Intronic
957544864 3:81624121-81624143 CAGAAGGCAAAGAGGAAGCAAGG + Intronic
957707089 3:83802953-83802975 CCAAAGCCAAATCTGGAGCAAGG - Intergenic
958063844 3:88517800-88517822 CAAAAGCAAAAATTGGAACATGG - Intergenic
960329765 3:116344383-116344405 TAACAGCCAAAGATGGAAGAAGG + Intronic
960793830 3:121462924-121462946 CAAAATCCAAAGATTCAACAAGG + Intronic
960820729 3:121728136-121728158 CAAAAGGAAAAGAAGGATCAAGG + Intronic
961794598 3:129400756-129400778 GAATAGCCACAGATGCAGCAGGG - Intergenic
963434311 3:145248804-145248826 CAAAAGTCAAAGATAAAGAAAGG - Intergenic
963801725 3:149682991-149683013 AAAAAGACAAAGATGGGGAAAGG + Intronic
964890125 3:161524786-161524808 CAAAACCCAAAAAAGGAGGATGG - Intergenic
965526927 3:169730600-169730622 CAAAAGCCAAAGATAAAGAAAGG - Intergenic
965950617 3:174303795-174303817 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
967732608 3:192919650-192919672 CAAAAAGCAATGATGAAGCAAGG - Intergenic
968530375 4:1087860-1087882 CAGAAGGCAAAGGGGGAGCAAGG - Intronic
970670753 4:18394157-18394179 CAGAAGGCAAAGGAGGAGCAAGG - Intergenic
971194404 4:24458103-24458125 CAAAAACTAAAGATGAAGGAAGG + Intergenic
971248711 4:24953375-24953397 GAAAAGACAAAAATGAAGCAGGG - Intronic
971734383 4:30427450-30427472 CAGAAGGCAAAGAGGGAACAAGG + Intergenic
972496010 4:39635461-39635483 AAAAAGCCAAAGTGGAAGCAGGG + Intronic
972932326 4:44088011-44088033 AAAAAGTGAAAGATGGAGCCTGG - Intergenic
973878735 4:55247581-55247603 TAAAAGCCCAAGATGGAGCGAGG + Intergenic
974808273 4:66911043-66911065 TATAAGCCATAAATGGAGCATGG + Intergenic
974891747 4:67892043-67892065 CCCAAGCCAATGATTGAGCAAGG + Intergenic
975132815 4:70845572-70845594 CAAAAGCCTAAGAGGGGGCCAGG - Intergenic
975596919 4:76056146-76056168 CAAAAGCTAAAGAAGGAGAAAGG - Intronic
976113735 4:81704094-81704116 CAAAAGTTAAATATGGGGCATGG + Intronic
976282830 4:83342081-83342103 CAGAAGGCAAAGAGGGAGCGAGG + Intergenic
976551702 4:86403640-86403662 CAGAAGACAAAGGGGGAGCAAGG + Intronic
976823676 4:89235328-89235350 CAGAAGCCAAAGGGGAAGCAAGG - Intergenic
977016238 4:91695887-91695909 CAGAAGGCAAAGAGGAAGCAGGG + Intergenic
977158400 4:93603328-93603350 CAAAAGCCTAAGCCAGAGCAAGG + Intronic
978831718 4:113094047-113094069 CAAAAGCCACAGATTAAGGAAGG - Intronic
980080745 4:128341336-128341358 CAGAAGGCAAAGAAGAAGCAAGG - Intergenic
980188867 4:129497083-129497105 GCAAAGGAAAAGATGGAGCATGG - Intergenic
980794271 4:137660691-137660713 AAAAAGCAAAACATGGGGCATGG + Intergenic
982256789 4:153458670-153458692 CAAAAGTCAAAGAGTCAGCAGGG - Intergenic
982319735 4:154065686-154065708 CAAAAGTCAAAGACAAAGCAAGG - Intergenic
982352689 4:154433223-154433245 CACAAGCCAAGGAGGGAGGAAGG + Intronic
982899343 4:160979287-160979309 CAAAAGTCAAGGATGAAGAAAGG - Intergenic
982917358 4:161228503-161228525 CAGAAGCCAAAGGGGAAGCAAGG + Intergenic
982950194 4:161684903-161684925 CAAAAACTCAAGATGGATCAAGG - Intronic
984334360 4:178369909-178369931 CAAAAGGCAAAGGGGAAGCAAGG + Intergenic
985497854 5:219640-219662 TAAAAGCCCAAGATGCGGCAGGG - Intronic
986203005 5:5596292-5596314 CAGAAGGCAAAGAGGGAGAAAGG - Intergenic
986207868 5:5643176-5643198 CAAAACCTTAAGATGGAGAAAGG + Intergenic
986685714 5:10273873-10273895 CACAAGCTAAACATGAAGCATGG + Intergenic
986723034 5:10573651-10573673 CAAAAGGCAAAGGGGAAGCAAGG + Intronic
987289424 5:16494584-16494606 CAGAAGGCAAAGAAGAAGCAAGG - Intronic
987374148 5:17218256-17218278 CAGCAGCCAAAGATGGAGGGTGG + Intronic
987639816 5:20598555-20598577 CAAAAGGCAAATGGGGAGCAAGG - Intergenic
989436223 5:41416651-41416673 CCAGAGCCAAAGATAGAGCTGGG + Intronic
990320909 5:54628809-54628831 CTAAGGCCAAAGCTGCAGCACGG - Intergenic
990623636 5:57587522-57587544 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
991047691 5:62240124-62240146 CAAAAGCCAAAGGTGAATCCTGG + Intergenic
991559141 5:67930663-67930685 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
991966697 5:72098798-72098820 CAACAGGCAGAGATGGAGAAAGG - Intergenic
992245240 5:74814736-74814758 CAAAACCCAGATATAGAGCAGGG - Intronic
993303443 5:86243458-86243480 AAAAAGCCAAATGTGAAGCAAGG + Intergenic
994964543 5:106652329-106652351 CAAAAGCAAAAAATGGGGAAAGG - Intergenic
994968347 5:106702832-106702854 CGAAAGGCAAAGGGGGAGCAAGG - Intergenic
995988839 5:118210819-118210841 CAAAAGACAAAGGGGAAGCAAGG - Intergenic
996065961 5:119079659-119079681 CAAATGCCAAAGAGAAAGCAAGG - Intronic
996065967 5:119079756-119079778 CAAATGCCAAAGAGAAAGCAAGG - Intronic
996434742 5:123422353-123422375 AAAAAGCTAAGGATGTAGCAAGG - Intronic
996519572 5:124412245-124412267 CAAGAGCCAAAGATTGAACTCGG + Intergenic
997540510 5:134657814-134657836 GAAAAGCCAAGGTGGGAGCACGG - Intronic
997868998 5:137490323-137490345 CTAAAGCCAAATCTGGAGCTTGG + Intronic
998013398 5:138713334-138713356 CAATAGCCAAATATTCAGCAAGG - Intronic
998104622 5:139460582-139460604 CAAGAGGCAAAGAAAGAGCAGGG - Intronic
998355638 5:141533694-141533716 AAAAAGCAAAAGTGGGAGCAAGG + Intronic
998577229 5:143329172-143329194 CAGAAGGCAAAGAGGAAGCAAGG + Intronic
998771777 5:145553931-145553953 CAAAAGTGAAGGATCGAGCATGG + Intronic
999418039 5:151416992-151417014 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
1002394226 5:178940874-178940896 GAAAAGCTGAAGATGGGGCAAGG - Intergenic
1002850340 6:989559-989581 CAGAAGGCAAGGAGGGAGCAAGG + Intergenic
1003402880 6:5805433-5805455 CAGAAGGCAAAGAGGAAGCAGGG - Intergenic
1003690683 6:8350859-8350881 CAAAAAAAAAAAATGGAGCAGGG - Intergenic
1004319981 6:14624840-14624862 AAAAAGACAAAGATGGAGGTGGG - Intergenic
1004519217 6:16346498-16346520 CTAAATGCAAAGAGGGAGCAAGG - Intronic
1004582637 6:16969346-16969368 TAAAAGCCTAAGAAGCAGCAAGG - Intergenic
1004980202 6:21014737-21014759 CAAAAACCAAATATTGAGCCAGG - Intronic
1005631817 6:27715219-27715241 CAAAAAACAAAGTTGGGGCAGGG + Intergenic
1006150212 6:31983049-31983071 CAAACTCCACAGAGGGAGCAGGG - Intronic
1006156513 6:32015787-32015809 CAAACTCCACAGAGGGAGCAGGG - Intronic
1006370895 6:33643055-33643077 GAAAAGACAAAGATGGAGCTTGG + Intronic
1006553992 6:34850282-34850304 CAAAAGTCAAGGATAGAGAAAGG - Intronic
1006681277 6:35798314-35798336 CATGAGCCTCAGATGGAGCAGGG + Intergenic
1007009481 6:38401292-38401314 CAGAAGGCAAAGAGGAAGCAAGG - Intronic
1007131937 6:39483364-39483386 CACAAGCAAGAGATGGAGGAAGG - Intronic
1007317250 6:40999248-40999270 AAACAGGCAAAGATGGCGCACGG + Intergenic
1008518755 6:52343355-52343377 CAATAGCCAAAGATGCTTCAGGG - Intergenic
1008871650 6:56279218-56279240 CAGAAGACAAAGGGGGAGCAAGG - Intronic
1009613983 6:65981787-65981809 CAAAAAGCAAAGATAGAGTAAGG - Intergenic
1010096708 6:72054936-72054958 CAAAAGCCAAAGTTGGCAAATGG - Intronic
1010682615 6:78814279-78814301 CAAAAGGCAAATATGGAGTGTGG + Intergenic
1011290993 6:85777201-85777223 CAAAGGCCAAAGATAGAGAAAGG - Intergenic
1011956048 6:93026612-93026634 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1013133899 6:107261414-107261436 CAGAAGGCAAAGTGGGAGCAGGG - Intronic
1013812406 6:114059688-114059710 CAGAAGGCAAAGAAGAAGCAAGG - Intronic
1013916111 6:115338911-115338933 CAAAAGCAAAATATAGAACATGG - Intergenic
1014034914 6:116755352-116755374 CCAAAGCCTAATATGGAGCAAGG + Intronic
1014956238 6:127620232-127620254 CATAAGCCAAAGAATGATCATGG + Intergenic
1015597641 6:134881042-134881064 CAAAAGCAAAAGAGGGAGGGAGG - Intergenic
1015602502 6:134924115-134924137 CAAAATCCAAATAGGGAGCTGGG + Intronic
1016311400 6:142737665-142737687 CAAAAGGCAAAGCAGGTGCAAGG + Intergenic
1017243696 6:152198315-152198337 CCAAAGCCTAATCTGGAGCAAGG - Intronic
1017858148 6:158369843-158369865 CAAAAGTCAAAGATGGAAAAGGG - Intronic
1019981080 7:4622710-4622732 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
1020357943 7:7298015-7298037 CAAAAGCCAAAAATGATGAATGG - Intergenic
1020904477 7:14048259-14048281 CAAAAGGCAAAGGGGAAGCAAGG - Intergenic
1021338982 7:19439784-19439806 CAAAAGGCAAAGAGGAAGCAGGG - Intergenic
1022352164 7:29576595-29576617 CAAAAGGCAAAAAGGAAGCAAGG - Intergenic
1023205491 7:37745223-37745245 CAAAAGCCAATGACTGAGAATGG - Intronic
1023658547 7:42450445-42450467 CAAGAGCCAAAGATGAAGGGAGG + Intergenic
1023942529 7:44779046-44779068 CAAAAGCCAAAGATGTTTGAGGG + Intergenic
1024662235 7:51509422-51509444 CAAAGGCCAAAGATAAAGAAAGG - Intergenic
1025860835 7:65326075-65326097 CAAAAGCCCAAGACTGAGGAGGG - Intergenic
1026958159 7:74391174-74391196 CAAATTGCAAAGATGGAACATGG - Intronic
1027542998 7:79491949-79491971 CAAAAGCAAAAGGTGGAAGAAGG - Intergenic
1027659071 7:80967229-80967251 CAGAAGGCAAAGAGGAAGCAAGG + Intergenic
1028296633 7:89140689-89140711 CAAAAGCCCAATCTAGAGCAAGG - Intronic
1028653197 7:93173559-93173581 CAAAAGGCAAAGGGGAAGCAAGG - Intergenic
1029031888 7:97477373-97477395 CAAATGCCAGAAAAGGAGCAGGG + Intergenic
1029513492 7:101011367-101011389 CAATAGCCAATGATGCAGCTGGG - Intronic
1030729708 7:112972069-112972091 CAGAAGGCAAAGGGGGAGCAAGG - Intergenic
1030758725 7:113323591-113323613 CAAAAAGCAAAGAAGAAGCATGG - Intergenic
1031077636 7:117228128-117228150 CAAAAGAGAGAGATGGAGTAAGG - Intronic
1031412867 7:121460972-121460994 CAGAAGAAAAAGAAGGAGCAGGG - Intergenic
1031642020 7:124176197-124176219 CAGAAGGCAAAGAGGAAGCAAGG - Intergenic
1032608064 7:133379657-133379679 TAAAAGCCAAAGATGGGGGGGGG - Intronic
1033262476 7:139855662-139855684 CAGAAGCCATATCTGGAGCAAGG + Intronic
1034003679 7:147444711-147444733 CAAGAGCCAAAGAGGAACCAGGG + Intronic
1035279308 7:157767226-157767248 CATAAGCCACAGATGGATGATGG - Intronic
1035608522 8:945538-945560 GAAGAGACAAAGATGGGGCAGGG - Intergenic
1036565964 8:9938306-9938328 GCAAGGTCAAAGATGGAGCATGG - Intergenic
1037568456 8:20137833-20137855 CAACAGCAAAATATAGAGCAAGG + Intergenic
1038121627 8:24623177-24623199 CAAAAGCATAAAATGGAGAAAGG + Intergenic
1038241866 8:25817494-25817516 CAAAAGCCAAAGATAAATAAGGG + Intergenic
1038410865 8:27358704-27358726 GAAAAGGCAAAGATGAAGCATGG - Intronic
1038478882 8:27887719-27887741 CACAAGCCCGAGATGGAGCAGGG + Intronic
1041309908 8:56505771-56505793 GTAAAGCCAGAGATGTAGCAAGG - Intergenic
1041405853 8:57498468-57498490 CAAAAGTCAAATCTGGAACATGG - Intergenic
1042421126 8:68590249-68590271 GAAAAGCAAAAGATGGAGGAAGG + Intronic
1042869843 8:73388411-73388433 AAAAAGCAAAAAATGGAGCCAGG + Intergenic
1042993867 8:74671599-74671621 CAAAACCCAAAGTTGGAACCCGG + Intronic
1043015266 8:74932051-74932073 CAAAAGCAATTCATGGAGCAAGG - Intergenic
1043198909 8:77338296-77338318 CAGAAGACAAAGAGGAAGCAAGG - Intergenic
1043457541 8:80427496-80427518 CAAAAGCTGAAGATGGGGCTGGG + Intergenic
1043517020 8:81004133-81004155 CAAAACACACAGATGGTGCACGG + Intronic
1043806035 8:84672638-84672660 CAGAAGGCAAAGGAGGAGCAAGG + Intronic
1044622984 8:94208945-94208967 CAAACACAAAAGACGGAGCAGGG + Intronic
1045439739 8:102197680-102197702 CAAAGGCCAGAGATGGGGAATGG + Intergenic
1046178111 8:110606084-110606106 CAGAAGGCAAAGGTGAAGCAAGG - Intergenic
1046361178 8:113158397-113158419 CAAAAGCCAAACATATTGCATGG - Intronic
1047610300 8:126514575-126514597 CAAAAGGCAAAGGGGGAGTAGGG + Intergenic
1048265981 8:132987063-132987085 AAAAAAAAAAAGATGGAGCATGG + Intronic
1048402474 8:134084673-134084695 CAAAAGCCAAAGATATATTAGGG + Intergenic
1049260489 8:141636350-141636372 CAAAGGCCACCGATGGAGGAAGG + Intergenic
1049548131 8:143244123-143244145 CAAAAGCAGAAGAAGGAGAAAGG - Intergenic
1049677070 8:143894819-143894841 CAGAAGCCCAAGATGGAGAGGGG + Intergenic
1052053818 9:23881741-23881763 CAGAAGGCAAAGGAGGAGCAGGG + Intergenic
1052104217 9:24492409-24492431 CAAAATCCAAAGATGGAGCGAGG + Intergenic
1052284903 9:26774110-26774132 AAAAAGCCAAAGTTGGAGACAGG - Intergenic
1052945750 9:34166900-34166922 CATAAGGCAAAGGGGGAGCAGGG + Intergenic
1055180094 9:73376828-73376850 CAAAAGGCACAGGGGGAGCAGGG - Intergenic
1055827194 9:80340877-80340899 CAAAAGCCAAATATAAAGAAAGG + Intergenic
1056052492 9:82784042-82784064 AAAAAGCGACAGAGGGAGCACGG - Intergenic
1056192531 9:84198555-84198577 CCAAAGGCAAAGGTGTAGCAAGG + Intergenic
1056707406 9:88963543-88963565 CAAAAGGCAAAGGGGAAGCAAGG - Intergenic
1058196403 9:101982205-101982227 CCAAAGCCTAATGTGGAGCAAGG + Intergenic
1058643311 9:107107854-107107876 CAAAAGCAAAGGAGGGAGGAAGG + Intergenic
1059719517 9:116945962-116945984 CAAAAGGCAAAGGGGAAGCAAGG + Intronic
1060089296 9:120728897-120728919 CAATGGCAAAAGATGGAGCCTGG - Intergenic
1061105274 9:128525339-128525361 CAAGAGGCACAGATGCAGCAGGG + Exonic
1061171167 9:128955557-128955579 CAATAGCCAAAGCTGAAACAAGG - Intronic
1185840319 X:3383505-3383527 GAAGAGCCTGAGATGGAGCAAGG + Intergenic
1187475957 X:19611210-19611232 CATAAGACTAAGATGAAGCATGG - Intronic
1188216677 X:27487440-27487462 AAAAAGACAAAAATGTAGCAGGG - Intergenic
1189017220 X:37296809-37296831 CAGAAGGCAAAGAGGGAGCAAGG + Intergenic
1189347421 X:40252589-40252611 CCAAAGCCAGAGTTGGGGCAAGG + Intergenic
1189931707 X:46018974-46018996 TAATGGCCAAAGGTGGAGCAGGG - Intergenic
1190271307 X:48865950-48865972 CAAAATACAAAGATGGGGCCGGG + Intergenic
1191650451 X:63531175-63531197 CAAATGCCAAGGATGAAGAAAGG + Intergenic
1192046881 X:67685055-67685077 CAGAAGCTGAAGCTGGAGCACGG + Intronic
1192295455 X:69842865-69842887 CAGAAGGCAAAGGTGGAGCAGGG - Intronic
1193050791 X:77097097-77097119 CAGAAGGCAAAGAAGAAGCAAGG - Intergenic
1194257337 X:91651158-91651180 CAAAAGTCAAAGATAAAGAAAGG - Intergenic
1194437929 X:93892767-93892789 CAAAAGTCAAAGATACAGAAAGG - Intergenic
1194839095 X:98716152-98716174 CAGAAGGCAAAGGTGGAGCAAGG - Intergenic
1195251861 X:103056297-103056319 CAATAGCCAAATATGGCTCATGG + Intergenic
1196504804 X:116428849-116428871 CCAAAGCCTAATTTGGAGCAAGG + Intergenic
1197272750 X:124443409-124443431 CCAAAGCCAAAAATGGATGAAGG + Intronic
1197601442 X:128535632-128535654 CAAACCCAAAAGATGGAGCTTGG - Intergenic
1197608709 X:128614515-128614537 CAGAAGCCAGATATGGTGCAGGG - Intergenic
1197835154 X:130686385-130686407 CAGAAGGCAAAGATGGAGCGAGG - Intronic
1198339345 X:135699033-135699055 CAAAGGCCAAAGTTAGAGCCTGG - Intergenic
1198551634 X:137751534-137751556 GGAAAGGCAAAGATGGAGCAGGG - Intergenic
1198610674 X:138396244-138396266 CAGAAGGCAAAGCAGGAGCAGGG - Intergenic
1199247859 X:145627220-145627242 CAAAGGTCAAGGATGGAGAAAGG + Intergenic
1199826332 X:151504186-151504208 CAAAGCCCAGAGAGGGAGCAAGG - Intergenic
1200412025 Y:2870330-2870352 AAAAATCCAAAAATGGAGCCAGG + Intronic
1200575995 Y:4890111-4890133 CAAAAGTCAAAGATGAAGAAAGG - Intergenic
1201483156 Y:14462498-14462520 CAAAAGCCAAAATTGGCACATGG + Intergenic
1201974627 Y:19835358-19835380 CCAAAACCAAAAATGGAGAAAGG - Intergenic