ID: 1143386676

View in Genome Browser
Species Human (GRCh38)
Location 17:6535115-6535137
Sequence GGCCCCACCACAACTAGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 62}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143386676 Original CRISPR GGCCCCACCACAACTAGAGT TGG Intronic
902725792 1:18335144-18335166 TGCCCCTCCACAACAAGAGCAGG - Intronic
915937780 1:160098960-160098982 CGCCCCACCAGGACTACAGTCGG + Intergenic
1064009969 10:11727841-11727863 GGCCTCACCACCACAGGAGTTGG - Intergenic
1064864310 10:19861746-19861768 AGCTCCACCTCAGCTAGAGTTGG + Intronic
1065112681 10:22455312-22455334 GGCCCCAGCAGAAGTAGAGGTGG - Intergenic
1066003389 10:31125342-31125364 GGCCACACCTCAAGTAGGGTTGG - Intergenic
1069359695 10:67627349-67627371 GAACCCAGGACAACTAGAGTAGG + Intronic
1076003707 10:126931584-126931606 GGCCCCACCCCAACCCCAGTGGG - Intronic
1081723464 11:45307004-45307026 GGCCCCACCTCAAGTAGCATGGG - Intergenic
1083295563 11:61713690-61713712 GGCTCCACCCCAGCTAGGGTGGG - Intronic
1085309108 11:75505762-75505784 GGCCCTATCACAAATATAGTAGG - Intronic
1092194598 12:6541633-6541655 TGCCCCACCACAGCTGGAGTTGG - Exonic
1096567850 12:52496236-52496258 GGCCCCACCACCACTAAAAGGGG + Intergenic
1102772806 12:115493253-115493275 GGCCGCAGCACAAGTAAAGTTGG + Intergenic
1105722962 13:23134852-23134874 GTCCCCACCACCAAGAGAGTGGG - Intergenic
1106487212 13:30182309-30182331 GCCCCCACCACAACTCAAGAGGG + Intergenic
1106644667 13:31619239-31619261 TGCCCCACCATTATTAGAGTTGG - Intergenic
1111540003 13:89657302-89657324 GGACCCAACAGAACTAGGGTAGG - Intergenic
1119854883 14:77892070-77892092 GGGCACACCACACCTGGAGTTGG - Intronic
1130611575 15:85366008-85366030 GTCCCCACCAGAACTGGAATTGG - Intergenic
1135427378 16:22350252-22350274 AGCCCCACCCCAACAAGAGTTGG - Intronic
1139757780 16:69158896-69158918 GGCAACACGACAACTAGTGTGGG - Intronic
1143386676 17:6535115-6535137 GGCCCCACCACAACTAGAGTTGG + Intronic
1143471513 17:7178621-7178643 GGGCTCACCAGGACTAGAGTGGG + Intronic
1145975607 17:28982098-28982120 GGCCCCCCCACTACTCGAGTTGG - Intronic
1158513709 18:58113783-58113805 TGCCACACAGCAACTAGAGTGGG - Intronic
1158624471 18:59059298-59059320 GGCCCCACCTCAGCCAAAGTTGG - Intergenic
1159999691 18:75004870-75004892 GGCCCCACCGCACTTAGAGATGG + Intronic
1161947867 19:7449558-7449580 GAACCCTCCAGAACTAGAGTGGG - Intronic
1167066062 19:47186987-47187009 GTCCCCACCACAGCTAGCATAGG + Intronic
1167605371 19:50479057-50479079 GGCCCCACCTCACCCGGAGTCGG - Exonic
930970152 2:57385597-57385619 GGCCCCACAGCAGCTAGAGGTGG - Intergenic
934525411 2:95048690-95048712 GGCCCCACCACCCCTACAGCAGG - Intronic
934601353 2:95661023-95661045 AGCCCTTCCACAACCAGAGTTGG + Intergenic
937368082 2:121279523-121279545 GGCCCCTCCACAATGAGAGGGGG + Intronic
941871151 2:170387235-170387257 GCCCCCATCACAACTCCAGTTGG - Exonic
1172034528 20:32001819-32001841 GGCCCCACCACAGCTTGAACTGG - Exonic
1172305598 20:33878073-33878095 TTCCCCACCTCAAATAGAGTCGG - Intergenic
1175953666 20:62596969-62596991 GGCCCCACGACAGCAAGCGTTGG - Intergenic
1178632736 21:34276888-34276910 GACCCCACCACAACGAGAATCGG - Intergenic
952980163 3:38727800-38727822 GACCCCACCATGACCAGAGTGGG + Intronic
953407488 3:42666651-42666673 GGCCCCACTACAGCCTGAGTAGG + Intergenic
962594625 3:136928043-136928065 GGCCCAACAAGAACAAGAGTTGG + Exonic
968955650 4:3717524-3717546 GGCCCTGCACCAACTAGAGTGGG + Intergenic
974143564 4:57919147-57919169 GACCCCACCACAGCTTGAGGAGG - Intergenic
980538442 4:134160591-134160613 GGAGCCACCACATCTAGATTTGG - Intergenic
980940771 4:139272074-139272096 GCCTACACCTCAACTAGAGTGGG + Intronic
997579139 5:135006218-135006240 GGACCCATGACAGCTAGAGTTGG - Intronic
998880083 5:146636613-146636635 GGCCCCACCAGAACTGTATTTGG + Intronic
999133086 5:149299422-149299444 GGCCCCCCACCACCTAGAGTTGG - Intronic
1000801634 5:165734778-165734800 GGCCCCAACACAATAATAGTTGG - Intergenic
1007450025 6:41935676-41935698 GGCCCACCCCCAGCTAGAGTTGG + Exonic
1010932142 6:81816172-81816194 GCCCTCTCCACAAATAGAGTTGG - Intergenic
1013528261 6:110995414-110995436 GGCCTGTCCACAACCAGAGTGGG - Intronic
1019598559 7:1869803-1869825 TGCCACACCACACCTAGACTGGG + Intronic
1028896578 7:96048335-96048357 GTCCCCACCATTACTAGAGCAGG + Intronic
1038378943 8:27074137-27074159 AGCCCCACCCCACCTAGATTAGG + Intergenic
1043934229 8:86125086-86125108 GGCCCCACCACTACTGTTGTTGG + Intronic
1050346168 9:4690286-4690308 GGCACTTCCACATCTAGAGTGGG + Intronic
1056377131 9:86025429-86025451 AGCCACTCCACAAATAGAGTGGG - Intergenic
1060213870 9:121726701-121726723 GCCCCCACCACATCTGGTGTTGG + Intronic
1190905469 X:54722913-54722935 GGCCCACCCACAACTAGATCTGG - Intergenic
1192907456 X:75566778-75566800 GAGCCCACCACAACTAAAGGAGG - Intergenic
1197435434 X:126422413-126422435 GGCCCCAATACAATAAGAGTTGG - Intergenic
1198781502 X:140241857-140241879 GGTCCCAACACAATTACAGTTGG - Intergenic
1198816748 X:140599657-140599679 GCCTACACCACAAATAGAGTAGG - Intergenic
1199818673 X:151423188-151423210 GGCCAAACCAGAACTACAGTTGG + Intergenic