ID: 1143390598

View in Genome Browser
Species Human (GRCh38)
Location 17:6557006-6557028
Sequence GACTTCGTGGGGGCCTCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143390598_1143390604 -4 Left 1143390598 17:6557006-6557028 CCAAGGGAGGCCCCCACGAAGTC No data
Right 1143390604 17:6557025-6557047 AGTCAAGAGGAAAGTCGCTCTGG No data
1143390598_1143390605 -3 Left 1143390598 17:6557006-6557028 CCAAGGGAGGCCCCCACGAAGTC No data
Right 1143390605 17:6557026-6557048 GTCAAGAGGAAAGTCGCTCTGGG No data
1143390598_1143390607 15 Left 1143390598 17:6557006-6557028 CCAAGGGAGGCCCCCACGAAGTC No data
Right 1143390607 17:6557044-6557066 CTGGGATCAGAGACAAGAGAGGG No data
1143390598_1143390606 14 Left 1143390598 17:6557006-6557028 CCAAGGGAGGCCCCCACGAAGTC No data
Right 1143390606 17:6557043-6557065 TCTGGGATCAGAGACAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143390598 Original CRISPR GACTTCGTGGGGGCCTCCCT TGG (reversed) Intergenic
No off target data available for this crispr