ID: 1143393885

View in Genome Browser
Species Human (GRCh38)
Location 17:6576704-6576726
Sequence CAGGGCCAACAGCAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143393885_1143393890 -9 Left 1143393885 17:6576704-6576726 CCTTCCTCTTGCTGTTGGCCCTG No data
Right 1143393890 17:6576718-6576740 TTGGCCCTGGGGCTTCCCTCAGG No data
1143393885_1143393898 20 Left 1143393885 17:6576704-6576726 CCTTCCTCTTGCTGTTGGCCCTG No data
Right 1143393898 17:6576747-6576769 CTTCTGCCTTTCAGACCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143393885 Original CRISPR CAGGGCCAACAGCAAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr