ID: 1143394132

View in Genome Browser
Species Human (GRCh38)
Location 17:6578603-6578625
Sequence CCCAGATGACGGCACTGGAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143394128_1143394132 6 Left 1143394128 17:6578574-6578596 CCTGAAATTCTTGTACTTCAGAG 0: 1
1: 0
2: 0
3: 16
4: 228
Right 1143394132 17:6578603-6578625 CCCAGATGACGGCACTGGACAGG 0: 1
1: 0
2: 0
3: 12
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143394132 Original CRISPR CCCAGATGACGGCACTGGAC AGG Exonic
901731474 1:11283257-11283279 CCCAAGTGACGCCACTGGTCTGG - Intronic
902391722 1:16110992-16111014 CCCAGATGGGGGCTCTGTACTGG + Intergenic
904116961 1:28169947-28169969 CCAAGATGACGCCATTGCACTGG + Intronic
904449102 1:30599656-30599678 ACCAGAAGAAGGCACTGTACTGG - Intergenic
905301729 1:36990336-36990358 CCCAGATGGCGGCCCAGGAGTGG - Intronic
908242975 1:62203463-62203485 CCAAGATCACGCCACTGTACCGG - Intronic
911127054 1:94350581-94350603 CCCAATAGAAGGCACTGGACTGG + Intergenic
911156502 1:94642611-94642633 GCCGGATGGTGGCACTGGACTGG - Intergenic
912720121 1:112012962-112012984 CCCAGATCTTGGCACTGTACAGG + Intergenic
914462905 1:147901229-147901251 CCCAGATGATGGGACGGGAGTGG + Intergenic
916097117 1:161361060-161361082 CCAAGATGGCGCCACTGGAGTGG + Intronic
919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG + Intronic
922217343 1:223531094-223531116 CCAAGATTAAGGCCCTGGACAGG + Intergenic
1063303413 10:4874525-4874547 CCCTGATGACTGCAAAGGACAGG + Intergenic
1065357179 10:24853555-24853577 CCAAGATCACGCCACTGCACTGG + Intronic
1065678874 10:28208650-28208672 GTCAGATGAGGGCACTGGATGGG - Intronic
1068739402 10:60451665-60451687 CCCAGCTGACTGCCCTGGTCTGG - Intronic
1070548378 10:77470497-77470519 CCCACATGAGGGCTCTGGGCAGG + Intronic
1074184174 10:111086765-111086787 CCCAGATGAAGGCATTGGGGAGG + Intergenic
1074776629 10:116772072-116772094 CTGAGATGACAGCACAGGACGGG + Intergenic
1077342001 11:2030379-2030401 CCCACACCACAGCACTGGACAGG - Intergenic
1083430468 11:62611579-62611601 CCCAGGTGACGGCCCTGCTCGGG - Exonic
1083736529 11:64684832-64684854 CCCAGATGCTCCCACTGGACAGG - Intronic
1083866518 11:65457213-65457235 CCGAGATCACGCCACTGCACTGG + Intergenic
1202824987 11_KI270721v1_random:85568-85590 CCCACACCACAGCACTGGACAGG - Intergenic
1092124084 12:6063756-6063778 CCCAGGTGAAGATACTGGACAGG + Intronic
1099066891 12:77991978-77992000 CCGAGATTACGCCACTGCACTGG + Intronic
1100081926 12:90862969-90862991 GCCAGATGACTGCACTGGGATGG - Intergenic
1103620278 12:122183273-122183295 CCCAGCTGCCGGCACCGCACGGG - Exonic
1104485746 12:129150093-129150115 CCCAGAGGACAGCACAGGCCAGG + Intronic
1105623217 13:22088805-22088827 CCCAGATGTCAGCACTGCAAGGG - Intergenic
1108224668 13:48275908-48275930 CCCAGATAATGGCCCTGGCCAGG - Intergenic
1108644157 13:52409589-52409611 CCAAGATGATGCCACTGCACAGG + Intergenic
1110787157 13:79542925-79542947 CCAAGATCACGCCACTGCACTGG - Intronic
1112038035 13:95515753-95515775 CCCAGAGGAAGGCGCTTGACTGG + Intronic
1113977039 13:114235242-114235264 CCCAGATGAAGGCCCAGGGCCGG - Intronic
1114266983 14:21078419-21078441 CCCGGCTGACGGCACTGCAGAGG + Exonic
1114721837 14:24890969-24890991 CCCAGATGGCAGCAGTGCACTGG - Intronic
1116053285 14:39831555-39831577 CACAGATGATGGCCCTGGCCAGG + Intergenic
1116747145 14:48834446-48834468 CCAAGATAGCGGCACTGCACTGG - Intergenic
1118037887 14:61888166-61888188 CCAAGATCACGCCACTGCACTGG - Intergenic
1120824542 14:88943607-88943629 CCAAGATGAAGGCACTGGCAAGG + Intergenic
1121252049 14:92506536-92506558 CCAAGAAGACGGCCCTGGCCTGG - Intergenic
1121491141 14:94361944-94361966 CCCACATGACTGCACAGCACAGG - Intergenic
1123448224 15:20344799-20344821 CCCAAAAAAGGGCACTGGACTGG - Intergenic
1128700233 15:69798617-69798639 CCCACATGAGGTGACTGGACTGG + Intergenic
1131784450 15:95896650-95896672 CCCAGATCACGCCACTGCACTGG + Intergenic
1132502082 16:288931-288953 CGAAGATGAGGGCCCTGGACGGG + Intronic
1137758900 16:50924894-50924916 CCCGGATGTCAGAACTGGACAGG - Intergenic
1140087219 16:71808283-71808305 CCGAGAGGACGGCACTGCAGGGG + Intronic
1142586311 17:976595-976617 CCCAGCTGAGGGCACTGGATGGG - Intronic
1142766998 17:2070452-2070474 CCCAGATGCAGGCACAGGGCTGG + Intronic
1143394132 17:6578603-6578625 CCCAGATGACGGCACTGGACAGG + Exonic
1144630912 17:16872009-16872031 CCCACAGGAGCGCACTGGACAGG + Intergenic
1144650403 17:17003467-17003489 CCCACAGGAGCGCACTGGACAGG - Intergenic
1146460998 17:33046058-33046080 CCCAGATGACACCACAGTACAGG - Intronic
1148860719 17:50603010-50603032 CCCAGGTGGTGGCACTGGGCTGG + Exonic
1149752434 17:59158869-59158891 CCAAGATCACGCCACTGCACTGG - Intronic
1152340566 17:79721782-79721804 CCCACAAAAGGGCACTGGACTGG + Intergenic
1153074732 18:1149046-1149068 CCCAGATGGCACCTCTGGACTGG + Intergenic
1153725715 18:7952643-7952665 CCAAGATGGCGACACTGCACTGG + Intronic
1155800642 18:30098925-30098947 CCTAGATCACAGCACTGCACTGG - Intergenic
1155820639 18:30370841-30370863 CGCAGATGAGGGCAATGGAGGGG - Intergenic
1160708139 19:539400-539422 CCCCGGGGACGGCACTGCACGGG - Intronic
1160840639 19:1145681-1145703 CACAGATGCCAGCTCTGGACAGG + Intronic
1161208708 19:3055586-3055608 CCAAGATGGCTGCAGTGGACAGG + Intronic
1161217502 19:3101677-3101699 CCCAGTTGTGGGCACTGGCCTGG - Intronic
1161456803 19:4373700-4373722 CCGAGATACCGGCTCTGGACTGG + Intronic
1163384270 19:16989748-16989770 CCAAGGTGATGGCACTGAACGGG - Exonic
1163654584 19:18538367-18538389 CCCTGAAGACGGCTGTGGACGGG - Exonic
1163675253 19:18652619-18652641 CCCAGGTGGCAGCACTGGGCTGG - Intronic
1164135199 19:22408018-22408040 CCGAGATCACGCCACTGCACTGG + Intronic
1164649265 19:29880286-29880308 CCGAGATCACGACACTGCACTGG + Intergenic
1164999455 19:32749118-32749140 CCCAGATGATGACACAGCACAGG - Intronic
1166673110 19:44723294-44723316 CCAAGATCACGCCACTGCACTGG + Intergenic
1168568383 19:57443184-57443206 CACAAATGAGGGCACAGGACTGG - Intronic
926175878 2:10591708-10591730 CCCAGATGACAGAACTGGCCAGG + Intronic
927488246 2:23503943-23503965 CCCAGATGAACCCACTGGGCTGG + Intronic
927509548 2:23635852-23635874 CCCAGATGATGGCAGTGGGAGGG + Intronic
936472750 2:112813389-112813411 CCTAGATGACAGCCCTGGAATGG - Intergenic
936872450 2:117148725-117148747 CCCAGATCGCGCCACTGCACTGG - Intergenic
941052183 2:160747585-160747607 CCCAGATGACAGCCCTGGCAGGG - Intergenic
942019180 2:171849850-171849872 CCAAGATCACGCCACTGGGCCGG - Intronic
942802801 2:179895120-179895142 CCCTGATGATGGAACTGGATAGG - Intergenic
943225333 2:185166549-185166571 CCGAGATCACGCCACTGCACTGG + Intergenic
946566350 2:220970086-220970108 TGTAGATGACTGCACTGGACTGG - Intergenic
948847143 2:240688491-240688513 CCCAGAGGAGTGCACAGGACAGG + Intergenic
949023085 2:241752300-241752322 CCCAGAGGACGCCCCTGGGCTGG - Intronic
1168891773 20:1299647-1299669 CCCAGAGTACTGCAGTGGACAGG + Intronic
1172566522 20:35934816-35934838 ACCAAATGACGGCCCTGGATAGG + Intronic
1172802019 20:37582388-37582410 CCCAGCTGAGGGGACTGCACTGG + Intergenic
1174318827 20:49724645-49724667 GCCAGATGACAGCAGTTGACTGG - Intergenic
1175410618 20:58765515-58765537 GCCAGCTGACAGCACTGGGCTGG + Intergenic
1175909618 20:62398559-62398581 CCCTGAGGACGGCGCTGGCCTGG - Intronic
1177594687 21:23222721-23222743 CCGAGATCACGCCACTGCACTGG + Intergenic
1178485765 21:33019539-33019561 CCCAGAAGACGCCACTGTGCCGG + Intergenic
1179578099 21:42320246-42320268 CCCAGCTGTCGGCCCAGGACTGG - Intergenic
1180085645 21:45506884-45506906 GCCAGATGAAGGGACTGGAGTGG - Intronic
1184692174 22:46122418-46122440 CCCAGCTGCAGGCGCTGGACAGG + Intergenic
1185325437 22:50223417-50223439 GCCTGATGACAGCACAGGACAGG + Intronic
951864265 3:27289640-27289662 TCCAGATGAAAACACTGGACTGG + Intronic
953257760 3:41306443-41306465 CCCAGATGGGGCCACTGGCCGGG - Intronic
953458169 3:43060596-43060618 TCCAGGTGAAGGCACTGGCCCGG + Intergenic
955277147 3:57557087-57557109 GCCCGATGTCGGCATTGGACGGG - Exonic
961675583 3:128563592-128563614 CCAACATGACGTCACTGAACAGG + Intergenic
962082028 3:132149953-132149975 CCCAGTTGAGGGCAAAGGACTGG - Intronic
966274500 3:178149364-178149386 ACCAGATGATGACACTGGAGGGG - Intergenic
966858227 3:184211155-184211177 CCCAGATCCCGCCACTGCACTGG + Intronic
968814269 4:2813626-2813648 CACAGAAGACCGCACTTGACAGG + Intronic
969084751 4:4647791-4647813 CCGAGATCACGCCACTGCACTGG + Intergenic
969840874 4:9880837-9880859 CCCAGATAACTGCCCTGGGCTGG + Intronic
970930264 4:21503060-21503082 CCCAGATGAAGACAGTGGACTGG - Intronic
971809766 4:31409477-31409499 CACAGATGATGGCCCTGGCCAGG + Intergenic
977552264 4:98454684-98454706 CCCCACTGACAGCACTGGACAGG - Intergenic
978263337 4:106790444-106790466 CCCAGATTATGGTACTGGGCAGG + Intergenic
978549621 4:109911493-109911515 CCCAGATGACAGCAATGGAAGGG - Intergenic
981090107 4:140723382-140723404 CCCAGATGACGCCATTGTACTGG - Intronic
983477359 4:168230284-168230306 ACCCCATGACGGCACTAGACAGG + Intronic
985643210 5:1073346-1073368 CCATGATTACGGCTCTGGACGGG + Intronic
987367676 5:17163842-17163864 CCAAGATCACGCCACTGCACTGG - Intronic
987520081 5:18970493-18970515 GCACGATGAAGGCACTGGACAGG - Intergenic
990274474 5:54180628-54180650 CACAGATGAAGGCTTTGGACTGG + Intronic
990841637 5:60086750-60086772 CCCATATGATGGGACTGGAGTGG - Intronic
991721076 5:69494236-69494258 CCCAGATGATGCCACTGCACTGG - Intronic
992058323 5:73015311-73015333 CCCAGATCACGCCACTGCACTGG - Intronic
992566445 5:77999591-77999613 CACAGGTGACCGCACTGGACTGG - Intergenic
997718354 5:136058701-136058723 CCCAGATGCCGGTGCTGGAAAGG + Intronic
998469554 5:142372780-142372802 CCGAGATGACGCCACTGCACTGG + Intergenic
1000359009 5:160430509-160430531 CCCAGAGGACGGCAATTAACTGG - Intergenic
1001049444 5:168402661-168402683 TACAGATGAGGGCACTGGAAGGG + Intronic
1001538931 5:172523484-172523506 CCCAGATGGAGTCACTGGACAGG + Intergenic
1006171776 6:32097270-32097292 CCCAGATGACTGCAATGATCAGG - Intronic
1006677698 6:35776274-35776296 CCGAGATCACGCCACTGCACTGG + Intergenic
1007040087 6:38713878-38713900 CCCAGATGCAGGCAGTGGACTGG + Intergenic
1008596534 6:53047779-53047801 CCCAAACAAAGGCACTGGACTGG + Intronic
1011888093 6:92122937-92122959 CCCAGTAGAGGGCACTGGAAAGG + Intergenic
1018595153 6:165471328-165471350 CCCAGATGAGATCACTTGACAGG - Intronic
1020125437 7:5530434-5530456 CCCAGACGGCGGCTCTGCACGGG + Intronic
1020560817 7:9727472-9727494 CCAAGGTGATGGCACTGAACGGG + Intergenic
1024724298 7:52175257-52175279 CCCAGATGTCATCACAGGACTGG - Intergenic
1029393637 7:100291859-100291881 CCGAGATCACGCCACTGCACTGG - Intergenic
1029409662 7:100400764-100400786 CCCAGATGCCTGCACTGTGCAGG + Intergenic
1029652025 7:101899874-101899896 CCCAGCCGAGGGCACTGGATGGG + Intronic
1029789026 7:102823009-102823031 CCGAGATCACGCCACTGCACTGG + Intronic
1032355723 7:131208721-131208743 CCCAGATGAAGGCACATGGCAGG - Intronic
1037624022 8:20592311-20592333 CCCAGAGCACGGCACAGCACAGG - Intergenic
1038295992 8:26291488-26291510 CCTAGGTGACGTCACTGGCCAGG + Intronic
1039914422 8:41849209-41849231 CCCTGATGTCTGCACTGGAAGGG + Intronic
1041616138 8:59908195-59908217 CCCTGAAGACAGCACAGGACTGG - Intergenic
1042142563 8:65694123-65694145 CCGAGATCACGCCACTGCACTGG - Intronic
1044896983 8:96902830-96902852 ACCAGAGGAGGGCAATGGACAGG + Intronic
1049386817 8:142347062-142347084 CCCAGCTCACTGCTCTGGACTGG + Intronic
1052642944 9:31192776-31192798 GCCAGATCACGGCTCTAGACTGG + Intergenic
1056951575 9:91044461-91044483 CTCAGCTGACGTCACTGGAGTGG - Intergenic
1057266874 9:93623009-93623031 AGCAGATGAAGGCACAGGACAGG - Intronic
1186824926 X:13329742-13329764 CCCAGATGATGGCAGTGACCAGG + Intergenic
1193208517 X:78777719-78777741 CCCTGCTGACAGCACTAGACAGG - Intergenic