ID: 1143395192

View in Genome Browser
Species Human (GRCh38)
Location 17:6589076-6589098
Sequence AGTATTGTACTTCTATTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 227}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143395192 Original CRISPR AGTATTGTACTTCTATTGTT AGG Intronic
904985198 1:34540540-34540562 AGTAGTCTTCTTCTATTTTTGGG - Intergenic
905517648 1:38573702-38573724 TGTTTTGCAATTCTATTGTTGGG - Intergenic
906897550 1:49793051-49793073 AGTAATGGACTTCCATTGTTTGG - Intronic
907099483 1:51815786-51815808 AAAATTGTATTTCTATTATTTGG + Intronic
907133067 1:52114210-52114232 AATCTTGGACTTCAATTGTTGGG + Intergenic
911113412 1:94217125-94217147 TGTATTTTTTTTCTATTGTTTGG + Intronic
911246796 1:95526798-95526820 AGTAGTGTTCTGCTATTGTCAGG + Intergenic
911860181 1:102937414-102937436 AGTAATTTACTGCTATCGTTTGG + Intronic
911873155 1:103125803-103125825 ATCATGGTACTTCTATTATTAGG + Intergenic
912281863 1:108324018-108324040 AGTATTCTACTGCTGCTGTTGGG + Intergenic
912771533 1:112468336-112468358 ATTATGGTAGTTCTATTTTTAGG + Intronic
916120905 1:161526927-161526949 ACTTTTGTACTTCGATTGGTTGG - Intergenic
916701046 1:167295134-167295156 AGAATGGTATTTCTACTGTTAGG - Intronic
917305101 1:173616683-173616705 AGTATTATAATTCTATATTTCGG - Intronic
917314368 1:173709435-173709457 GGAATTGTACTTCTAATATTAGG - Intergenic
917322461 1:173797534-173797556 AGTATTGTACTTTTTATGTAAGG - Intergenic
917761985 1:178171533-178171555 AATATTTTACTTGTATAGTTGGG + Intronic
918201594 1:182272433-182272455 AGTATTTAACTTTTATTGTGTGG + Intergenic
918849034 1:189659622-189659644 AGTATTGTCTTTATAGTGTTAGG + Intergenic
919226178 1:194706271-194706293 AGTATTTTTCTGCTATAGTTTGG - Intergenic
919279656 1:195472360-195472382 AGTATTGCACTTCTCTCGTGGGG + Intergenic
919391869 1:196995599-196995621 TATATTGCACTTCTATTTTTGGG - Intronic
921909762 1:220535049-220535071 CGTATGTTAGTTCTATTGTTGGG + Intronic
921990031 1:221355962-221355984 AATATTGTAGTTCTATTTCTGGG + Intergenic
922121767 1:222677100-222677122 AGTCTTATACTTCTTTTGTTGGG + Intronic
1062853538 10:765533-765555 CGTATGGTAGTTCTATTTTTAGG - Intergenic
1063504896 10:6588685-6588707 AGAATTTCAGTTCTATTGTTTGG - Intergenic
1065195170 10:23257343-23257365 AGTAGTGCACTGCTATTGCTTGG - Intergenic
1066091063 10:32020996-32021018 AGTATTATACTTCTCTAGTTAGG - Intronic
1066546680 10:36507669-36507691 ATTCTTGGGCTTCTATTGTTTGG - Intergenic
1067396365 10:45923411-45923433 ATTATTGTACTTCTCTACTTTGG - Intergenic
1067864684 10:49892517-49892539 ATTATTGTACTTCTCTACTTTGG - Intronic
1068369350 10:56093440-56093462 AGTATTTTACTTCAATTATGTGG + Intergenic
1068795055 10:61070142-61070164 AATTTTGTACTGCTATGGTTTGG - Intergenic
1069352593 10:67547215-67547237 ATTATTATACTTGTATTTTTTGG - Intronic
1070118596 10:73553320-73553342 AGTCTTGCTCTGCTATTGTTAGG + Intronic
1070443764 10:76473778-76473800 GATTTTGTACTTCTTTTGTTGGG - Intronic
1070508192 10:77135450-77135472 TGTATGGTAGTTCTATTTTTGGG - Intronic
1072899626 10:99395530-99395552 AGTATTTAATTTCTCTTGTTAGG - Intergenic
1074629677 10:115238449-115238471 AGTCTTGTACATATTTTGTTAGG + Intronic
1077754138 11:5007132-5007154 AGTCTTGTACTTCTTTTACTAGG + Intergenic
1077941158 11:6845101-6845123 AGTATTGTACTACAATTCTGTGG - Intergenic
1080202514 11:29689391-29689413 AGGATTATGCTTCAATTGTTTGG - Intergenic
1087975343 11:104538727-104538749 AGTATTGTCATTTTGTTGTTTGG + Intergenic
1093826515 12:23697049-23697071 AGAATTATTCTTCTGTTGTTGGG + Intronic
1094432199 12:30381492-30381514 AATCTTGTACTTATTTTGTTAGG - Intergenic
1094634655 12:32213992-32214014 ATTATTGTAATTCTACTGTAAGG + Intronic
1098923586 12:76325665-76325687 AGTATTATACTTCAAGTTTTAGG - Intergenic
1099615028 12:84923298-84923320 AGTATTGGATTTATATTGTGGGG - Intergenic
1099644738 12:85338168-85338190 AGGATTATACTTCTTGTGTTGGG - Intergenic
1100667897 12:96774802-96774824 AGTCTTGTACTTTTCTGGTTAGG + Intronic
1104225355 12:126827417-126827439 AGTATCCCACTTTTATTGTTTGG + Intergenic
1105697743 13:22906451-22906473 AATATTGAACTTTTATTATTTGG - Intergenic
1107871872 13:44754271-44754293 AGTATTGAACTGCTAATCTTTGG + Intergenic
1108311440 13:49195501-49195523 AGTATTATACTGTTATTTTTAGG + Intronic
1108785039 13:53889841-53889863 CATATTGTAATTCTATTTTTAGG + Intergenic
1108853229 13:54761739-54761761 GGTATTTTATTTCTAATGTTTGG - Intergenic
1112195732 13:97224336-97224358 AGTATTGTACTTCCCCTGCTTGG - Intronic
1114131374 14:19797075-19797097 ATTATTATACTTCTTATGTTTGG + Intronic
1118202468 14:63689175-63689197 AATATTATAGTTCTTTTGTTGGG - Intronic
1119991728 14:79205597-79205619 ATTATTGTATTTTTATTGCTTGG + Intronic
1120602970 14:86535330-86535352 AGTATTATACTTCAAGTTTTAGG - Intergenic
1123574438 15:21652667-21652689 ATTATTATACTTCTTATGTTTGG + Intergenic
1123611053 15:22095254-22095276 ATTATTATACTTCTTATGTTTGG + Exonic
1123861558 15:24473256-24473278 ATTATTGTACTTTAATTTTTAGG + Intergenic
1124097871 15:26666283-26666305 AGTAGTGTATTTCTATTGCTTGG + Intronic
1124952285 15:34334929-34334951 AGAATTGTATTTTTATTCTTTGG - Intronic
1126487729 15:49201140-49201162 AATATTGTACTTTTATTTTCAGG + Exonic
1127018622 15:54718816-54718838 AATATTGTTTTTCCATTGTTTGG + Intergenic
1127922837 15:63506164-63506186 AGTATTGCAGTTCTTTTGTGAGG + Intronic
1128927864 15:71675165-71675187 AAGATGGTACTTCTGTTGTTGGG - Intronic
1202983301 15_KI270727v1_random:387010-387032 ATTATTATACTTCTTATGTTTGG + Intergenic
1135999070 16:27276714-27276736 AGTATTGTACGTATATGGTGGGG + Intronic
1138856905 16:60705334-60705356 ATTATTGTACTTCAAGTTTTAGG + Intergenic
1140032172 16:71347582-71347604 AGTATTGTATTTTTATTAATGGG - Intergenic
1143395192 17:6589076-6589098 AGTATTGTACTTCTATTGTTAGG + Intronic
1146132020 17:30286091-30286113 AATAGTCTACTTCTAATGTTGGG + Intronic
1147484479 17:40799186-40799208 AGTATTGTAGTTCTAAATTTAGG - Intronic
1150912019 17:69398300-69398322 AGTATGGTACTACTAATTTTAGG - Intergenic
1152184822 17:78848888-78848910 AATATTGTAATTCCACTGTTTGG + Intergenic
1152548320 17:81014537-81014559 TGTTTTGAAATTCTATTGTTAGG - Intergenic
1153595243 18:6718532-6718554 AGTACTGTAGTTTTATAGTTAGG - Intergenic
1153745492 18:8174531-8174553 AGTATTGTGCTTATACTGCTTGG - Intronic
1154073132 18:11173410-11173432 AGAATTGTAGTTCTGTTGGTGGG - Intergenic
1155517918 18:26641345-26641367 AATATTTTACTTGTATAGTTTGG + Intronic
1155947039 18:31865863-31865885 AGTACTGTATTTGTATTTTTTGG - Intronic
1156716722 18:40021237-40021259 AATATTGTACTTCTAGTTTCTGG + Intergenic
1159386944 18:67738973-67738995 AGTATTCTATTTGTATTTTTAGG + Intergenic
1160126255 18:76175099-76175121 ATAATTGTTCTTCTATTGTGAGG - Intergenic
1168396441 19:56052754-56052776 AGTTTTGTGCTTCTATTCTTAGG - Intronic
925334958 2:3089839-3089861 TGTTTTGGAGTTCTATTGTTAGG - Intergenic
928998091 2:37317570-37317592 AGTATTGTACATCTTTTGTGTGG - Intronic
929528243 2:42726365-42726387 ATTATTGTACTTCAAGTTTTAGG + Intronic
932907709 2:75771362-75771384 AATATGGTAGTTCTATTTTTAGG - Intergenic
933380105 2:81531883-81531905 AATATTGTGCTTATATTGCTTGG + Intergenic
935393171 2:102575844-102575866 AGTCTTGGACTTCTATTTGTTGG + Intergenic
936850338 2:116889199-116889221 CTTATGGTACTTCTATTTTTAGG + Intergenic
938275062 2:130012563-130012585 ATTATTCTACTTCTATGGTGTGG - Intergenic
938326019 2:130403291-130403313 ATTATTCTACTTCTATGGTGTGG - Intergenic
938363923 2:130718174-130718196 ATTATTCTACTTCTATGGTGTGG + Intergenic
938440310 2:131324719-131324741 ATTATTCTACTTCTATGGTGTGG + Intronic
939182933 2:138825201-138825223 ACTATTGTACTCCTATCTTTTGG + Intergenic
939350829 2:141035336-141035358 ATTATTGTACTTCAAGTTTTAGG - Intronic
941255374 2:163223416-163223438 AGTATTGTATTTGTACTGTGTGG - Intergenic
941571267 2:167173667-167173689 AGTATGGTAGCTCTATTTTTAGG + Intronic
942313191 2:174675113-174675135 AGTAATATAATTCTATTTTTAGG + Intronic
942420919 2:175806642-175806664 AGTATTGTAAGTCTATTCCTCGG + Intergenic
942956647 2:181781469-181781491 TGTATTGTACTTATCTTGCTGGG - Intergenic
943467791 2:188250902-188250924 AGTAGTTTACTAGTATTGTTTGG + Intergenic
945479386 2:210326577-210326599 TGTATGGTAGTTCTATTTTTTGG + Intergenic
946920960 2:224581877-224581899 TGTATTTTACATCTGTTGTTTGG - Intronic
948967021 2:241390511-241390533 AGTCTTGTCCATCTGTTGTTTGG + Intronic
1169398391 20:5257194-5257216 AGTCTTGTACATGTTTTGTTAGG - Intergenic
1170073529 20:12394797-12394819 GGGATGTTACTTCTATTGTTAGG + Intergenic
1170862068 20:20115312-20115334 AGTATTTCTCTTCTATTCTTTGG - Intronic
1171254042 20:23672889-23672911 TTTATTATACTTCTATTATTTGG + Intergenic
1171260546 20:23728153-23728175 TTTATTATACTTCTATTATTTGG + Intergenic
1172412653 20:34737109-34737131 ATAATTGTACCTCTATGGTTTGG - Intronic
1172527595 20:35609537-35609559 AGTATTGTACATCTGTTTTAGGG - Intergenic
1175565100 20:59968420-59968442 AGTCTTGTACATGTATTTTTTGG + Intronic
1179595578 21:42440940-42440962 ATTTTTTTACTTCTATTATTTGG + Intronic
1180249655 21:46574031-46574053 TGTATTCTATTTTTATTGTTGGG - Intergenic
1182304608 22:29359178-29359200 CGTATTGTATTTCTACTGTGAGG - Intronic
1184733975 22:46387225-46387247 TGTTTTGTATTTCAATTGTTCGG - Intronic
951971276 3:28447077-28447099 AGTATTGTTCTTTAAGTGTTTGG - Intronic
952835687 3:37600143-37600165 ATTATTGTATTTATAATGTTAGG - Intronic
953460539 3:43078473-43078495 AGTTTTGGCCTTTTATTGTTGGG - Intergenic
956242335 3:67143920-67143942 TATACAGTACTTCTATTGTTTGG - Intergenic
958005708 3:87808242-87808264 GGTCCTGTACTTCTGTTGTTGGG + Intergenic
958201441 3:90321450-90321472 ATTATTATACTTTTATTTTTAGG - Intergenic
959039893 3:101409188-101409210 AGTATTTTATTTTTATTTTTTGG - Intronic
960797063 3:121498632-121498654 AGGATTGGACTACTATTGATTGG - Exonic
964965211 3:162483451-162483473 AGTATTTTTTTTCTATTTTTAGG + Intergenic
965264705 3:166527479-166527501 AGAATAGTACTTTTATTTTTTGG + Intergenic
965528047 3:169742160-169742182 ATTATGGTACTACTATTCTTAGG - Intergenic
965660303 3:171034322-171034344 AGTCTTGTACATGTTTTGTTAGG + Intergenic
965681084 3:171252313-171252335 AGTTTTCTACTTCTTGTGTTCGG - Intronic
965874761 3:173302741-173302763 AGTATTTTACATCTATAGTCAGG - Intergenic
966226872 3:177607262-177607284 TGTATTGAAGTTCTACTGTTTGG + Intergenic
966725547 3:183104725-183104747 ATTATTGTATTTCTCTTATTTGG - Intronic
967708893 3:192683058-192683080 AGGATTATAGTTCTATTATTAGG - Intronic
969867018 4:10082871-10082893 AGCATTGTTCTCCTGTTGTTGGG - Intronic
970242569 4:14024915-14024937 AGGATTTTACATCCATTGTTTGG - Intergenic
971151739 4:24040111-24040133 AGTATTGGATGTCTATTGGTTGG - Intergenic
972027926 4:34410729-34410751 AGTCTTGTACTCTTATTGTGTGG + Intergenic
972113325 4:35594051-35594073 ATTATTGTACTTCCATTTTATGG + Intergenic
973797599 4:54444255-54444277 ACTCTTGTCTTTCTATTGTTAGG + Intergenic
974397722 4:61360758-61360780 AGTATTGTATTTCTAGTATGTGG - Intronic
975334231 4:73157116-73157138 ATAATTATACTTCTTTTGTTCGG + Intronic
975784270 4:77871038-77871060 AGTATGTTAGTTCTATTATTAGG - Intronic
976585117 4:86788575-86788597 AGTATTGTAATTGTACTCTTTGG + Intronic
978119203 4:105058098-105058120 AATATCGTACTTCTATTGATTGG - Intergenic
978642587 4:110888913-110888935 AGAATTTTATTTTTATTGTTTGG + Intergenic
978776770 4:112513400-112513422 AATATAGTACTTGTATTTTTGGG - Intergenic
979025003 4:115559324-115559346 ATTATTTTACTTTTATTGCTGGG + Intergenic
979044263 4:115841118-115841140 AGTCTTGTACTTTTCTTCTTTGG + Intergenic
979316208 4:119266789-119266811 AATATTTTTCTTCTATGGTTTGG + Intronic
979325611 4:119375852-119375874 AGTATAATACTTGAATTGTTTGG - Intergenic
980437978 4:132803989-132804011 AGGATTTTACTTTTATTGTGTGG - Intergenic
980894560 4:138849778-138849800 AGTATTTAGCCTCTATTGTTTGG - Intergenic
981975282 4:150721199-150721221 GGGTTTCTACTTCTATTGTTTGG - Intronic
982360152 4:154510988-154511010 AGCATTGTAATTTTATTTTTTGG + Intergenic
982547450 4:156752175-156752197 ACTATTATACTTCAATTGCTGGG + Intergenic
982626961 4:157779756-157779778 AGTTTATTTCTTCTATTGTTAGG - Intergenic
983243520 4:165260993-165261015 AGTATAATACTTAAATTGTTTGG - Intronic
983910474 4:173233271-173233293 TGTATGGTAGTTCTATTTTTAGG + Intronic
984340981 4:178455420-178455442 AACATTGTATTTATATTGTTTGG + Intergenic
986553989 5:8991841-8991863 AGTAAAGTACTTCGATTCTTTGG + Intergenic
986908802 5:12528337-12528359 AGCAATGTACTCCAATTGTTAGG + Intergenic
987629077 5:20444085-20444107 AGTATTGTCCCTTTATTGCTAGG + Intronic
987946308 5:24613476-24613498 TGTATTTTTCTGCTATTGTTTGG + Intronic
989442106 5:41485159-41485181 ACTATTCTACTTCCATTTTTAGG + Intronic
991989305 5:72321327-72321349 AGAATGGTACTTCTCTTGCTGGG - Intronic
992100071 5:73398436-73398458 TGTATTGTACTACTATTGTAGGG + Intergenic
992469376 5:77041617-77041639 CATATTCTTCTTCTATTGTTAGG - Intronic
993803389 5:92374245-92374267 AGTTTGTTACTTCTAATGTTCGG + Intergenic
995366964 5:111373067-111373089 TGTATTTTACTTTTGTTGTTTGG - Intronic
995646741 5:114321181-114321203 TAAATTGTACTTCTATGGTTTGG - Intergenic
995922932 5:117335097-117335119 AATTGTGTACTTCTAGTGTTGGG + Intergenic
996080121 5:119249625-119249647 TGTATTGTGTTTCCATTGTTGGG - Intergenic
996298711 5:121955532-121955554 CATATGGTAGTTCTATTGTTAGG + Intergenic
997774886 5:136594352-136594374 AGTATTGTACATCTTTTATTAGG + Intergenic
1000507764 5:162142915-162142937 ATTTTTTTACTTCTATAGTTGGG + Intronic
1000787380 5:165562150-165562172 ACCATTGTAATTCTAATGTTAGG - Intergenic
1003703038 6:8491994-8492016 AGTATTATTTTTCTAATGTTAGG - Intergenic
1003853326 6:10247126-10247148 GGTATTGTGCTTCTAGTCTTGGG - Intergenic
1004765224 6:18719264-18719286 ATTCTTGTACTACTATTGCTTGG + Intergenic
1005064522 6:21805585-21805607 AAAATTGTACTTTTTTTGTTGGG - Intergenic
1005557584 6:27003373-27003395 AGAACTGTTGTTCTATTGTTTGG - Intergenic
1010649065 6:78429422-78429444 ATTATTGTAGTTTTATTGTCAGG - Intergenic
1010936014 6:81862405-81862427 AGTATTGTATGTGTATGGTTTGG + Intergenic
1011831682 6:91380888-91380910 AGTATTGCACTTATGTTTTTAGG + Intergenic
1013328887 6:109077774-109077796 ATTTGTGTACTTCTTTTGTTTGG + Intronic
1013870315 6:114750597-114750619 AATATTTTACTTCTAATTTTAGG + Intergenic
1014397789 6:120947748-120947770 AATCTTGTCCTTCTATTGTTTGG - Intergenic
1016487837 6:144562739-144562761 AGAATGGTAGTTCTGTTGTTAGG + Intronic
1017021764 6:150145277-150145299 TGTATTGTACTTTTCTTCTTGGG + Intronic
1020761623 7:12274104-12274126 TGTATTGTAGTTCTATTTTTAGG + Intergenic
1023631551 7:42169711-42169733 ATTATTAATCTTCTATTGTTGGG - Intronic
1024162525 7:46691716-46691738 AGTATTGTAAGTCTAATATTGGG + Intronic
1024720385 7:52130329-52130351 AATATTCTAATTCTATTGTATGG + Intergenic
1025043294 7:55667216-55667238 AGGATTGTTTTTCTATTTTTTGG - Intergenic
1025136212 7:56415732-56415754 AGGATTGTTTTTCTATTTTTTGG - Intergenic
1026387887 7:69869074-69869096 AGTATTGCACTGTTAATGTTTGG + Intronic
1028812175 7:95100414-95100436 AGTATTCTTCTTATATTATTTGG - Intronic
1031570277 7:123350616-123350638 TGTATGGTAGTTCTATTTTTAGG + Intergenic
1031884449 7:127231224-127231246 ACTATTCTACTTCTCTTGATGGG + Intronic
1032598687 7:133269937-133269959 AGTATGGTACTGATATGGTTTGG + Intronic
1036628303 8:10491358-10491380 ATTATTGTACTTCAAGTTTTAGG + Intergenic
1039648859 8:39318575-39318597 AGTTTTTTCCTTCTATTGGTTGG + Intergenic
1041611686 8:59857549-59857571 AGTACTGGGCTTCTATTGGTTGG - Intergenic
1041867189 8:62588620-62588642 AATTTTATAATTCTATTGTTTGG + Intronic
1043147460 8:76676366-76676388 GTTAGTGTACTGCTATTGTTTGG + Intergenic
1044378712 8:91506009-91506031 AGTCTTTTACCTCTTTTGTTAGG + Intergenic
1044495325 8:92871497-92871519 AGTATTGTACTTCCTTTCTCTGG - Intergenic
1045146948 8:99356326-99356348 AGTATTTTACTTCTTTTTTAGGG - Intronic
1045345899 8:101293199-101293221 ATTATTTTACTTGTATTGTAAGG - Intergenic
1046042147 8:108918693-108918715 AGAATTGTATACCTATTGTTTGG - Intergenic
1046509419 8:115182487-115182509 ATTATTGGACTTTTATTGTAAGG - Intergenic
1048785145 8:138042587-138042609 ATTATTATACTTCAAGTGTTAGG + Intergenic
1048944989 8:139437323-139437345 AGTATTCAACTGCTTTTGTTGGG - Intergenic
1050287049 9:4114347-4114369 ATTAGTGTACATCTATTGTTTGG + Intronic
1052201361 9:25785300-25785322 AGTATAGTAGTTTTTTTGTTTGG - Intergenic
1052669717 9:31540540-31540562 AGTACTGTGCCTCCATTGTTAGG + Intergenic
1057001799 9:91516794-91516816 AGTTTTATACTTCAATTTTTGGG - Intergenic
1058287627 9:103199215-103199237 ATTATAATACTTCTATGGTTAGG - Intergenic
1059101758 9:111478848-111478870 AGTATTGTAATTCCTTTGGTGGG + Intronic
1061737787 9:132673992-132674014 TGTATTGTGCATCAATTGTTAGG + Intronic
1061992807 9:134169177-134169199 AGTACTGTATTTCTACAGTTCGG - Intergenic
1203355431 Un_KI270442v1:133809-133831 ATTATTGTACTTCAAGTTTTAGG - Intergenic
1185815305 X:3149550-3149572 AGAATTGTATTTCTACTGATGGG - Intergenic
1185985638 X:4829353-4829375 ATTATTGTACTTATTTTATTTGG + Intergenic
1186172956 X:6896904-6896926 ATTATTGCAATTCCATTGTTTGG + Intergenic
1187087366 X:16054937-16054959 TGTATTTTATTTATATTGTTGGG + Intergenic
1187977470 X:24717706-24717728 AGTATTCCACTTTTATTGGTTGG + Exonic
1191751114 X:64543824-64543846 ATTATTGTACTTTTAGTTTTAGG + Intergenic
1194052303 X:89085287-89085309 AATATTTTTCTTCTATTATTTGG - Intergenic
1194549664 X:95281179-95281201 ATTATTGTGCTTTTATTTTTTGG - Intergenic
1197101165 X:122656962-122656984 AATATTTTACTTCTTTGGTTAGG - Intergenic
1197212028 X:123836106-123836128 AGTGTTGTATTTTTAGTGTTGGG + Intergenic