ID: 1143397391

View in Genome Browser
Species Human (GRCh38)
Location 17:6612058-6612080
Sequence GCGGATATAGTTCTGGAAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 74}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143397391_1143397395 12 Left 1143397391 17:6612058-6612080 CCTTCTTCCAGAACTATATCCGC 0: 1
1: 0
2: 0
3: 1
4: 74
Right 1143397395 17:6612093-6612115 AAGCTCACTCTGCAACCTCTGGG 0: 1
1: 0
2: 1
3: 17
4: 234
1143397391_1143397394 11 Left 1143397391 17:6612058-6612080 CCTTCTTCCAGAACTATATCCGC 0: 1
1: 0
2: 0
3: 1
4: 74
Right 1143397394 17:6612092-6612114 CAAGCTCACTCTGCAACCTCTGG 0: 1
1: 0
2: 1
3: 26
4: 174
1143397391_1143397396 19 Left 1143397391 17:6612058-6612080 CCTTCTTCCAGAACTATATCCGC 0: 1
1: 0
2: 0
3: 1
4: 74
Right 1143397396 17:6612100-6612122 CTCTGCAACCTCTGGGTCTCCGG 0: 1
1: 0
2: 42
3: 3186
4: 59069

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143397391 Original CRISPR GCGGATATAGTTCTGGAAGA AGG (reversed) Exonic
905512263 1:38530731-38530753 GGAGATCTAGGTCTGGAAGAAGG + Intergenic
906516187 1:46440203-46440225 GCGAAGATAGATTTGGAAGAGGG + Intergenic
922985409 1:229862506-229862528 GATGACAGAGTTCTGGAAGATGG - Intergenic
1072492974 10:95926972-95926994 GAGGAGATAGTTTGGGAAGATGG + Intronic
1074024327 10:109618318-109618340 GCAAATATTGTTCTGGATGAAGG + Intergenic
1076316791 10:129547661-129547683 GAGGATAGCTTTCTGGAAGAAGG - Intronic
1078364840 11:10697933-10697955 GTGGACATATTTCTGGAAGCTGG + Intergenic
1079772528 11:24480317-24480339 TGAGATATAATTCTGGAAGAGGG + Intergenic
1093385264 12:18545363-18545385 GAGAATATGGTTTTGGAAGATGG - Intronic
1094679187 12:32652460-32652482 GCAGATATAGATGTGGAAGGGGG + Intergenic
1096555937 12:52403799-52403821 GCTGATATAGCCCTCGAAGATGG + Exonic
1098297559 12:69019316-69019338 GCAGATATAGTTCTAGATCAGGG + Intergenic
1102474008 12:113176924-113176946 GTGGCAATAATTCTGGAAGAGGG + Exonic
1104959224 12:132480290-132480312 GCGGAGAAAGGTCTGGAAGGTGG - Intergenic
1105005391 12:132718018-132718040 GTGGATGTAGTTCCGGAAGGCGG - Exonic
1107067513 13:36231195-36231217 ATGGATGGAGTTCTGGAAGATGG + Intronic
1107735127 13:43391278-43391300 GCAGTTATAGTTTAGGAAGAAGG - Intronic
1108065935 13:46577572-46577594 GTGGATATAGTGTTGAAAGAAGG + Intronic
1111925775 13:94462018-94462040 GAAGGTAGAGTTCTGGAAGAAGG + Exonic
1116005004 14:39283241-39283263 TCGGATAAATATCTGGAAGAAGG + Intronic
1117330184 14:54704665-54704687 GCTGACATACCTCTGGAAGAAGG + Intronic
1121011031 14:90520511-90520533 GCGGATGTTGTTTTGGAAAAGGG - Intergenic
1122927443 14:104912279-104912301 AAGGATATATTTCAGGAAGAAGG + Intergenic
1124410904 15:29435837-29435859 TCGGTTTTAGTGCTGGAAGATGG + Intronic
1127944442 15:63736213-63736235 GCTCATATACTTCTGCAAGAGGG + Intronic
1129887194 15:79046931-79046953 CCGGATGTAGTCCTGGATGATGG + Exonic
1138729996 16:59184050-59184072 GCAGATATGGTGTTGGAAGAGGG + Intergenic
1143397391 17:6612058-6612080 GCGGATATAGTTCTGGAAGAAGG - Exonic
1153782494 18:8506607-8506629 GGGGACCAAGTTCTGGAAGAAGG - Intergenic
1156148987 18:34222305-34222327 GCGGCTTTATTTGTGGAAGAGGG + Intronic
1156218030 18:35021392-35021414 ATGGACAAAGTTCTGGAAGATGG + Intronic
1157182205 18:45507704-45507726 GCGGACATCTTCCTGGAAGAAGG + Intronic
1159461442 18:68726060-68726082 GGGGAGATGCTTCTGGAAGAAGG + Intronic
1159469653 18:68835776-68835798 AAGGACATAGTTCTGGAAGAAGG - Intronic
1160416183 18:78712810-78712832 GTGGATATAGTTCTTTGAGATGG - Intergenic
929855218 2:45631869-45631891 GGGCATCCAGTTCTGGAAGATGG + Intergenic
931693362 2:64853960-64853982 ATGGCTATACTTCTGGAAGATGG - Intergenic
943063826 2:183066586-183066608 GAGGATAGATTTCTAGAAGAAGG + Intergenic
946894842 2:224313035-224313057 GGGGATAAAGTTATGGAGGAAGG - Intergenic
1173122137 20:40303560-40303582 TCGGATAAACTTCTGGAACATGG - Intergenic
1173594309 20:44248610-44248632 GCTGATATGGTTGTTGAAGAAGG + Intronic
1175362731 20:58426384-58426406 GTGGATTCAGTCCTGGAAGATGG + Intronic
1175518784 20:59586354-59586376 GGGGATTTAGTCATGGAAGACGG - Intronic
1177156433 21:17505886-17505908 AAGGACATACTTCTGGAAGAAGG + Intergenic
1178122970 21:29488145-29488167 GCATAGATACTTCTGGAAGAAGG + Intronic
1182957583 22:34441822-34441844 GCAGATGGAGTTCTGGTAGAAGG - Intergenic
949855033 3:8453417-8453439 GCGGAGACAGACCTGGAAGAAGG + Intergenic
950873403 3:16248822-16248844 GCAGAAATAGTGCTGGAATAAGG - Intergenic
953692133 3:45128405-45128427 CTGGATATAATTCTGGAAGTTGG - Intronic
957302199 3:78406674-78406696 GCTGCTATAATTCTGCAAGAAGG - Intergenic
958065499 3:88540506-88540528 ACGGATACAGTTTTGCAAGATGG + Intergenic
969230962 4:5830761-5830783 GCTGAAATAGTTCTGAAAAAAGG - Intronic
970505102 4:16721053-16721075 GAGGACATAGTTTTGGAATAAGG - Intronic
975841663 4:78480750-78480772 GCAGATATACTGCTGGCAGAGGG + Intronic
977524962 4:98132733-98132755 GAGGATATAGTTCTAGTAAAAGG + Intronic
981331266 4:143513368-143513390 CCGGCTAGAGATCTGGAAGAGGG + Intergenic
990719824 5:58681893-58681915 GCTGAGATAATGCTGGAAGAAGG + Intronic
992269124 5:75048012-75048034 GAGGATGTAGTTCTAGAACATGG + Intergenic
998280278 5:140800334-140800356 GAGGCTATAGTTCTTGAAAAAGG + Intronic
1012138276 6:95586568-95586590 GTTGATGAAGTTCTGGAAGAAGG - Exonic
1012677900 6:102139784-102139806 ACATATATAGTTCTGGAAAATGG + Intergenic
1013848133 6:114479327-114479349 GCTGATATGGTTATGGGAGAGGG + Intergenic
1018377131 6:163223639-163223661 GAGGATTTAATTTTGGAAGAGGG + Intronic
1026417235 7:70195037-70195059 TTGGATATGGCTCTGGAAGATGG + Intronic
1028491208 7:91414203-91414225 GCTGATTTAGGTCTGGAAAAAGG - Intergenic
1036293152 8:7513179-7513201 ACCAATATAGTTCTGGAAGCAGG - Intergenic
1036329405 8:7807821-7807843 ACCAATATAGTTCTGGAAGCAGG + Intergenic
1037011663 8:13851021-13851043 GCGGAAATAGCTCTGCAAGCGGG - Intergenic
1039196073 8:35033126-35033148 GTGGCTATAGTTCTGCAAGTGGG + Intergenic
1044226879 8:89729325-89729347 GCAGATACAGTTGTAGAAGAAGG - Intergenic
1045355789 8:101387829-101387851 AAGGTTATAGTTCTGGATGAAGG - Intergenic
1050772673 9:9222055-9222077 GCAGTTCTAGTTGTGGAAGAAGG - Intronic
1061490524 9:130941506-130941528 TAGGACATCGTTCTGGAAGAAGG + Intergenic
1188942369 X:36255599-36255621 CTGGATATAATGCTGGAAGATGG - Intronic
1197766387 X:130061855-130061877 GCTGATACAGTTATGGGAGAGGG - Intergenic
1200862589 Y:8008867-8008889 GTGGATACAGTTCAGGAAAAAGG + Intergenic