ID: 1143397392

View in Genome Browser
Species Human (GRCh38)
Location 17:6612065-6612087
Sequence ATTAGATGCGGATATAGTTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 97}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143397392_1143397396 12 Left 1143397392 17:6612065-6612087 CCAGAACTATATCCGCATCTAAT 0: 1
1: 0
2: 0
3: 16
4: 97
Right 1143397396 17:6612100-6612122 CTCTGCAACCTCTGGGTCTCCGG 0: 1
1: 0
2: 42
3: 3186
4: 59069
1143397392_1143397399 27 Left 1143397392 17:6612065-6612087 CCAGAACTATATCCGCATCTAAT 0: 1
1: 0
2: 0
3: 16
4: 97
Right 1143397399 17:6612115-6612137 GTCTCCGGAAGCTCCGTATCGGG 0: 1
1: 0
2: 0
3: 1
4: 31
1143397392_1143397398 26 Left 1143397392 17:6612065-6612087 CCAGAACTATATCCGCATCTAAT 0: 1
1: 0
2: 0
3: 16
4: 97
Right 1143397398 17:6612114-6612136 GGTCTCCGGAAGCTCCGTATCGG 0: 1
1: 0
2: 0
3: 0
4: 25
1143397392_1143397394 4 Left 1143397392 17:6612065-6612087 CCAGAACTATATCCGCATCTAAT 0: 1
1: 0
2: 0
3: 16
4: 97
Right 1143397394 17:6612092-6612114 CAAGCTCACTCTGCAACCTCTGG 0: 1
1: 0
2: 1
3: 26
4: 174
1143397392_1143397395 5 Left 1143397392 17:6612065-6612087 CCAGAACTATATCCGCATCTAAT 0: 1
1: 0
2: 0
3: 16
4: 97
Right 1143397395 17:6612093-6612115 AAGCTCACTCTGCAACCTCTGGG 0: 1
1: 0
2: 1
3: 17
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143397392 Original CRISPR ATTAGATGCGGATATAGTTC TGG (reversed) Exonic
903802563 1:25980454-25980476 ATTAGCTGGGCATATAGTCCTGG - Intronic
917123332 1:171663706-171663728 ATTATCTGTGGTTATAGTTCTGG + Intergenic
922645992 1:227287377-227287399 ATTATTTGCAGAAATAGTTCAGG - Intronic
922934917 1:229415177-229415199 ATGAGATGCGGCTGTAGTCCAGG - Intergenic
1068422540 10:56814544-56814566 ATTAGAAGGGGATTTATTTCAGG + Intergenic
1081356911 11:42123381-42123403 ATGAGATGCGGCTGTAGTCCAGG - Intergenic
1084354294 11:68626946-68626968 ATGAGATGCGGCTGTAGTCCAGG - Intergenic
1084776044 11:71376352-71376374 ATGAGATGAGGATAGAGTTAGGG + Intergenic
1088300029 11:108348031-108348053 ATTAGATGAGGAAATAGTGGGGG + Intronic
1093584419 12:20819918-20819940 ATGAGATGCGGCTGTAGTCCAGG + Intronic
1094400781 12:30058782-30058804 ATGAGATGCGGCTGTAGTCCAGG - Intergenic
1096177367 12:49531535-49531557 ATCATATGCTGGTATAGTTCTGG - Intergenic
1097305137 12:58060309-58060331 ATTAGATGCATATATATTTAGGG - Intergenic
1097318894 12:58203743-58203765 ATTACAAGCTGATATTGTTCAGG + Intergenic
1097398687 12:59104636-59104658 ATGAGATGCGGCTATAGTCCAGG - Intergenic
1100990861 12:100250076-100250098 ATTAGAGGCTGATACATTTCAGG - Intronic
1101528447 12:105553085-105553107 ATTAGATGCTGAGATCTTTCAGG + Intergenic
1108192721 13:47959053-47959075 ATAAAATGCTAATATAGTTCAGG + Intronic
1109499390 13:63215916-63215938 ATGAGATGCGGCTGTAGTCCAGG - Intergenic
1115146073 14:30227472-30227494 ATTAGATGAAGATTTTGTTCTGG + Intergenic
1115240501 14:31248262-31248284 ATGAGATGCGGCTGTAGTCCAGG + Intergenic
1116534681 14:46015328-46015350 ATGAGATGCGGCTGTAGTCCAGG + Intergenic
1117801284 14:59446884-59446906 ATGAGATGCGGCTGTAGTCCAGG - Intronic
1117957817 14:61136329-61136351 ATGAGATGCGGCTGTAGTCCAGG + Intergenic
1126912311 15:53429748-53429770 ATGAGATGCGGCTATAGTCCAGG + Intergenic
1133651494 16:7817500-7817522 ATGAGATGCGGCTGTAGTCCAGG - Intergenic
1133766661 16:8842999-8843021 ATGAGATGCGGCTGTAGTCCAGG + Intronic
1139969288 16:70763701-70763723 ATGAGAAACGGATATTGTTCAGG + Intronic
1143397392 17:6612065-6612087 ATTAGATGCGGATATAGTTCTGG - Exonic
1152032193 17:77850476-77850498 ATTAGATATGGATATAGATGTGG + Intergenic
1157906294 18:51572942-51572964 ATGAGATGCGGCTGTAGTCCAGG + Intergenic
1161661826 19:5551278-5551300 ATGAGATGCGGCTGTAGTCCAGG - Intergenic
1161712204 19:5855221-5855243 ATGAGATGTGGCTATAGTCCAGG - Intergenic
1168227887 19:55009703-55009725 ATGAGATGCGGCTGTAGTCCAGG + Intergenic
926407864 2:12572558-12572580 ATGAGATGCTGCTATAGTCCAGG - Intergenic
926815444 2:16794844-16794866 ATGAGATGCGGCTATAGTCCGGG + Intergenic
930364855 2:50426592-50426614 ATTAGATGTGGAAATTGTCCTGG - Intronic
930955197 2:57195762-57195784 ATGAGATGTGGCTATAGTCCAGG - Intergenic
931026295 2:58116328-58116350 ATGAGATGCGGCTATAGTCCGGG + Intronic
931850517 2:66246729-66246751 ATGAGATGCAGCTATAGTCCAGG - Intergenic
939651994 2:144774898-144774920 ATTAAATGAGGATAATGTTCAGG - Intergenic
941340491 2:164298650-164298672 ATGAGATGTGGCTATAGTTCAGG - Intergenic
941397541 2:164991877-164991899 ATTAGATGCCTATTAAGTTCAGG - Intergenic
943660236 2:190552229-190552251 CTCAGATGCTGATATAATTCAGG + Intergenic
945858217 2:215092387-215092409 ATTAGATGTGGCTATAGTCCAGG - Intronic
946214939 2:218176944-218176966 ATGAGATGCGGCTGTAGTCCAGG + Intergenic
948192364 2:236069749-236069771 ATTACATGGGGAGATAGTTATGG + Intronic
1168926363 20:1583496-1583518 ATTAGATGATGATATGGTTATGG + Intronic
1170820603 20:19754058-19754080 ATGAGATGCGGCTGTAGTCCAGG + Intergenic
1173118969 20:40271853-40271875 ATGAGATGCGGCTATAGTCCAGG - Intergenic
1177411744 21:20738707-20738729 ATGAGATGCTGATATGGTTTGGG + Intergenic
1177967729 21:27749217-27749239 ATTATATGCTGATATTATTCAGG - Intergenic
952699005 3:36305403-36305425 ATGAGAAGAGGATATAGATCAGG + Intergenic
953177298 3:40563780-40563802 ATGAGATGCGGCTGTAGTCCAGG - Intronic
953825608 3:46249216-46249238 ATGAGATGCGGCTATAGTCCAGG + Intronic
957668890 3:83274550-83274572 ACTAGATGAGGATATATTTTTGG + Intergenic
963456569 3:145554091-145554113 ATGAGATGCGGCTGTAGTCCAGG + Intergenic
965286637 3:166827019-166827041 ATGAGATGCGGCTGTAGTCCAGG + Intergenic
965713510 3:171579221-171579243 ATGAGATGTGGCTATAGTCCAGG - Intergenic
966104996 3:176324536-176324558 ATGAGATGCAGCTATAGTCCAGG + Intergenic
967723202 3:192837124-192837146 AACAGATGCTGACATAGTTCTGG - Intronic
970476135 4:16425789-16425811 ATCAGATGGGGATATATTTGTGG + Intergenic
971689592 4:29815702-29815724 ATTACATGCTGAAATTGTTCTGG + Intergenic
972612928 4:40671843-40671865 ATTAGGTGCAGAAATAGCTCAGG + Intergenic
975992814 4:80278045-80278067 ATTCTAGGAGGATATAGTTCTGG - Intronic
976993233 4:91396302-91396324 TTTAGCTGTGGATAAAGTTCTGG + Intronic
978438702 4:108711817-108711839 ATGAGATGCGGCTGTAGTCCAGG - Intergenic
979302844 4:119107168-119107190 ATTAGATTCAGATATATTTCTGG + Intergenic
981525306 4:145701892-145701914 ATGAGATGCGGCTGTAGTCCAGG - Intronic
982497015 4:156106388-156106410 ATGAGATGCGGCTGTAGTCCAGG + Intergenic
983023971 4:162711901-162711923 ATGAGATGCGGCTGTAGTCCAGG - Intergenic
986193625 5:5518346-5518368 ATGAGATGTGGCTATAGTCCAGG - Intergenic
986905871 5:12492591-12492613 ATGAGATGCGGCTGTAGTCCAGG - Intergenic
987282139 5:16422811-16422833 ATGAGATGCGGCTGTAGTCCAGG - Intergenic
987966605 5:24885552-24885574 ATTAGATGTCTAGATAGTTCAGG - Intergenic
991333489 5:65520006-65520028 TTTATATGCTGATATAGTTTAGG + Intronic
1001995997 5:176159036-176159058 ATCAGATGCGGAGACAGTTTTGG - Intergenic
1006066513 6:31466221-31466243 ATTAGAAGTGGATATAGCCCGGG - Intergenic
1007300878 6:40867114-40867136 ATGAGATGTGGCTATAGTCCAGG + Intergenic
1007990054 6:46245737-46245759 ATTTGATGTGGGTAAAGTTCAGG - Intronic
1010662408 6:78586188-78586210 ATGAGATGCGGCTATAGTCCAGG - Intergenic
1010665466 6:78624806-78624828 GTTAGATGTGAATAGAGTTCAGG - Intergenic
1010698740 6:79013445-79013467 GTTAGATGAGGATATTTTTCTGG - Intronic
1010894449 6:81348054-81348076 ATGAGATGCGGCTATAGTCCAGG + Intergenic
1011707451 6:90015946-90015968 ATTAGATGCATATATATTTAGGG + Intronic
1013299612 6:108792129-108792151 ATTATTTGAGGATATACTTCAGG - Intergenic
1013995168 6:116299947-116299969 ATTAGATGGAAATATAGTTGTGG + Intronic
1014699432 6:124665338-124665360 ATTACATGTGGATTTATTTCTGG - Intronic
1014718993 6:124894841-124894863 ATGAGATGAGGCTATAGTCCAGG - Intergenic
1015165314 6:130195142-130195164 ATGAGATGCGGCTGTAGTCCAGG - Intronic
1015801284 6:137064237-137064259 ATGAGATGTGGCTATAGTCCAGG + Intergenic
1016114047 6:140260355-140260377 ATGAGATGCAGCTGTAGTTCAGG + Intergenic
1020732300 7:11895928-11895950 ATTAAATGCAGATATGCTTCCGG + Intergenic
1034241291 7:149613121-149613143 ATTACATGGGGGTATAGCTCAGG - Intergenic
1037639075 8:20726301-20726323 ATTGGCTGTGAATATAGTTCTGG - Intergenic
1038083738 8:24171051-24171073 ACTAGATTCGGAGATAATTCAGG - Intergenic
1042018267 8:64341402-64341424 ATTATATTCTGATATAATTCTGG - Intergenic
1046503220 8:115105636-115105658 ATTGGATGTGTATATAGGTCTGG + Intergenic
1046559370 8:115817401-115817423 ATGAGATGCGGCTGTAGTCCAGG - Intergenic
1046675777 8:117106661-117106683 ATTAGATGGGGACATAGAACAGG - Intronic
1048585330 8:135770058-135770080 ATGAGATGCAGCTATAGTCCAGG + Intergenic
1051849184 9:21488612-21488634 ATGAGATGCGGCTATGGTCCAGG + Intergenic
1052720554 9:32167437-32167459 ATGAGATGCGGCTGTAGTCCAGG + Intergenic
1058612489 9:106791000-106791022 ATGAGATGCGGCTGTAGTTCAGG - Intergenic
1058817341 9:108696542-108696564 ATTACATTCTAATATAGTTCTGG - Intergenic
1190472683 X:50798745-50798767 ATTAGATGCATATTTTGTTCTGG - Intronic
1193641611 X:84015541-84015563 ATTAGATACGGATTTATGTCTGG - Intergenic
1194186155 X:90776233-90776255 ATGAGATGTGGCTATAGTCCAGG + Intergenic
1194308448 X:92275975-92275997 ATGAGATGCGGCTATAGTCCAGG + Intronic
1194351383 X:92827294-92827316 ATGAGATGCGGCTATAGTCCAGG - Intergenic
1195908583 X:109868133-109868155 ATGAGATGCGGCTGTAGTCCAGG + Intergenic
1197065014 X:122224836-122224858 ATGAGATGCGGCTATAATCCAGG - Intergenic
1200532748 Y:4358313-4358335 ATGAGATGCGGCTATAGTCCAGG + Intergenic
1200659705 Y:5943986-5944008 ATGAGATGCGGCTATAGTGCAGG - Intergenic