ID: 1143397393

View in Genome Browser
Species Human (GRCh38)
Location 17:6612077-6612099
Sequence TGAGCTTGATGTATTAGATG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 139}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143397393_1143397399 15 Left 1143397393 17:6612077-6612099 CCGCATCTAATACATCAAGCTCA 0: 1
1: 0
2: 0
3: 18
4: 139
Right 1143397399 17:6612115-6612137 GTCTCCGGAAGCTCCGTATCGGG 0: 1
1: 0
2: 0
3: 1
4: 31
1143397393_1143397396 0 Left 1143397393 17:6612077-6612099 CCGCATCTAATACATCAAGCTCA 0: 1
1: 0
2: 0
3: 18
4: 139
Right 1143397396 17:6612100-6612122 CTCTGCAACCTCTGGGTCTCCGG 0: 1
1: 0
2: 42
3: 3186
4: 59069
1143397393_1143397394 -8 Left 1143397393 17:6612077-6612099 CCGCATCTAATACATCAAGCTCA 0: 1
1: 0
2: 0
3: 18
4: 139
Right 1143397394 17:6612092-6612114 CAAGCTCACTCTGCAACCTCTGG 0: 1
1: 0
2: 1
3: 26
4: 174
1143397393_1143397398 14 Left 1143397393 17:6612077-6612099 CCGCATCTAATACATCAAGCTCA 0: 1
1: 0
2: 0
3: 18
4: 139
Right 1143397398 17:6612114-6612136 GGTCTCCGGAAGCTCCGTATCGG 0: 1
1: 0
2: 0
3: 0
4: 25
1143397393_1143397395 -7 Left 1143397393 17:6612077-6612099 CCGCATCTAATACATCAAGCTCA 0: 1
1: 0
2: 0
3: 18
4: 139
Right 1143397395 17:6612093-6612115 AAGCTCACTCTGCAACCTCTGGG 0: 1
1: 0
2: 1
3: 17
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143397393 Original CRISPR TGAGCTTGATGTATTAGATG CGG (reversed) Exonic
902525121 1:17052325-17052347 TGAGCTTGGTGTGTTACCTGTGG - Intronic
903801306 1:25970543-25970565 TGACTATAATGTATTAGATGTGG - Intronic
907600857 1:55767971-55767993 GGTGCTTGATGTATTAGTTAAGG - Intergenic
909117866 1:71562466-71562488 TGACTATGAGGTATTAGATGAGG - Intronic
911458580 1:98159960-98159982 CGAACTTGCTTTATTAGATGGGG + Intergenic
912690019 1:111797903-111797925 TGTGGTGGATGTATTGGATGGGG + Intronic
918389629 1:184045186-184045208 TGTACTGGATGTTTTAGATGGGG + Intergenic
919718525 1:200806854-200806876 TGTTCTGGATGAATTAGATGAGG + Intronic
924261020 1:242231547-242231569 AGCTGTTGATGTATTAGATGAGG - Intronic
1062900346 10:1140056-1140078 TAAGTTAAATGTATTAGATGTGG + Intergenic
1063243482 10:4194659-4194681 TGAGGATGATGTGTAAGATGGGG - Intergenic
1064635280 10:17358864-17358886 TGACCTTGATCTATGATATGTGG + Intronic
1065685436 10:28279938-28279960 AGAACTTGATGTGTGAGATGAGG + Intronic
1069725435 10:70574590-70574612 TGAGCTGGATGGATTATTTGAGG - Intergenic
1072616260 10:97050519-97050541 TGAGCTTGATGCAGAAGAGGTGG - Intronic
1078118146 11:8476646-8476668 TGGGCTTGTTGTTTTAGATGAGG - Intronic
1079207310 11:18427400-18427422 TTAGCTTGATCTTGTAGATGAGG + Intronic
1079430374 11:20383959-20383981 TGATCTTCATGTCTTAGATGGGG + Intergenic
1080288036 11:30639433-30639455 TGAGCATCATGTATTTTATGTGG - Intergenic
1080755848 11:35197941-35197963 TGAGATTTATGTATTAGCTTCGG + Intronic
1081130049 11:39368397-39368419 TGAGTTTGAAGTATTATATTTGG - Intergenic
1082206272 11:49438402-49438424 TGAGTATGATGTGTTAGCTGTGG + Intergenic
1082225380 11:49700099-49700121 TGAGCATGATGTATGTGCTGAGG + Intergenic
1086623711 11:88919606-88919628 TGAGCATGATGTATGTGCTGAGG - Intronic
1086648995 11:89263380-89263402 TGAGTATGATGTGTTAGCTGTGG - Intronic
1087108449 11:94435872-94435894 TGAGGTAGATGAATCAGATGTGG - Exonic
1087717597 11:101626318-101626340 TGGGTTTCATGTATAAGATGAGG + Intronic
1090159772 11:124480724-124480746 TGAGTGTGATGTATTGCATGAGG + Intergenic
1090287578 11:125513209-125513231 TGGGCATGATGTCCTAGATGTGG - Intergenic
1090661637 11:128886440-128886462 AGAGCATGATGTAGAAGATGTGG - Intergenic
1092203315 12:6600645-6600667 TGAGGATGATGACTTAGATGTGG - Exonic
1095763562 12:45868646-45868668 TTAGCTTGATGTATAAAATGAGG + Intronic
1095952432 12:47789185-47789207 TGAGCCTGATGTTAGAGATGCGG - Intronic
1096175947 12:49519257-49519279 TGAGTTTAATATATTAGATATGG - Intronic
1097174919 12:57137007-57137029 TGAGATGGATGTATCAGATGAGG + Intronic
1101521416 12:105485726-105485748 TGAGCTTCCTGTCTTAGAAGGGG - Intergenic
1105007839 12:132733811-132733833 TGAGCCTGATATTTTAGATTTGG - Intronic
1107317459 13:39148899-39148921 TAAGCTTTATGTACTAAATGGGG + Intergenic
1108239858 13:48452318-48452340 TGAGCTTGATGTTTTATTTATGG + Intronic
1109305032 13:60629152-60629174 TGATGTTGATGAATTAGATGTGG - Intergenic
1109493454 13:63134140-63134162 TTAGCTTGCTTTATTAGGTGTGG - Intergenic
1111734041 13:92114807-92114829 TGAGGTTAATGAATTAGAAGTGG + Intronic
1112717284 13:102201651-102201673 TGAGCATGATGTATAAGACAAGG + Intronic
1118547545 14:66908671-66908693 TGATCTTGATCTCTTAGCTGAGG - Intronic
1121526590 14:94623625-94623647 TGTGCTTGATGTATTTGAGGAGG + Exonic
1121694039 14:95898323-95898345 TGGGGTTCATGTATTACATGAGG + Intergenic
1122828055 14:104381577-104381599 TGATCTTGAAGTGTTAGAGGAGG + Intergenic
1124914185 15:33952673-33952695 TGAGATTGTTGAACTAGATGTGG + Intronic
1125463351 15:39926845-39926867 GGATCTTGATGTCTTCGATGGGG + Intergenic
1128686897 15:69693414-69693436 GGAACTGGAGGTATTAGATGAGG - Intergenic
1129064199 15:72887709-72887731 TGTGGTTTATGTCTTAGATGAGG - Intergenic
1133109634 16:3539901-3539923 TGACATTGATGTTTTTGATGAGG + Intronic
1138525813 16:57606586-57606608 TGAGCTCGAACTATTAGAAGTGG - Intergenic
1138545339 16:57715846-57715868 GGAGCCTGATGGATGAGATGAGG - Intronic
1138823920 16:60295578-60295600 TTAGATTGATATATCAGATGGGG - Intergenic
1143397393 17:6612077-6612099 TGAGCTTGATGTATTAGATGCGG - Exonic
1146538096 17:33670641-33670663 TGAGGTTGATGGATTAGAGGGGG - Intronic
1147550001 17:41434659-41434681 TGAGCTTCATCTTTTAGAAGCGG + Intergenic
1149018536 17:51936573-51936595 TGAGCCTGATGGACCAGATGAGG + Intronic
1149371576 17:55998602-55998624 TGAGACTGATGTATTAAATTAGG - Intergenic
1150234082 17:63578472-63578494 TCAGCTTGTTGGTTTAGATGAGG + Exonic
1150360621 17:64530449-64530471 TGAGCTTGATATTTTAGGGGTGG + Intronic
1156398265 18:36718310-36718332 TGACATTGATGTCCTAGATGTGG + Exonic
1167784326 19:51625136-51625158 AGAGCTGGAAGGATTAGATGAGG + Intronic
927424741 2:22969545-22969567 GGAGCTTGACATATTAAATGAGG - Intergenic
933245919 2:79974872-79974894 TGAGCTTGAGGTCTTAGATTAGG + Intronic
941794065 2:169581060-169581082 TGAGCCTAAAGTATTAGATTTGG - Intergenic
942420481 2:175801809-175801831 TGACCTTGATTTTGTAGATGAGG - Intergenic
943198262 2:184784134-184784156 TGTGCTTCATGTTTTAGGTGGGG + Intronic
945326658 2:208490010-208490032 TGTAGTGGATGTATTAGATGAGG - Intronic
946457519 2:219839790-219839812 TGAGCTTGATTTAGAAGATTTGG + Intergenic
1173689527 20:44949460-44949482 AGAGCTGCATGTGTTAGATGAGG - Intronic
1178274471 21:31224442-31224464 TGAGCTTCATGTTTTGGAGGTGG - Intronic
1179089325 21:38249892-38249914 TTAGCTTAATGTATTTGTTGTGG + Intronic
1180632187 22:17237311-17237333 TGAGCTTGCTATTTTAGGTGAGG + Intergenic
1185236438 22:49716275-49716297 AGAGCCTGATGTATTTCATGCGG - Intergenic
951279780 3:20733698-20733720 TTAGCTGCATTTATTAGATGAGG - Intergenic
952852195 3:37738595-37738617 TGAGGTTGATGAATTTGATAAGG + Intronic
953529698 3:43729221-43729243 GGAGCTTGATGTGTGAGAAGTGG + Intronic
955056105 3:55457482-55457504 TGTGCATGATGGTTTAGATGGGG - Intergenic
955815177 3:62834577-62834599 TGACCTTGATGTTTCTGATGAGG - Intronic
956561841 3:70586962-70586984 GTAGCATGATGTATTAGAAGAGG + Intergenic
957713114 3:83889894-83889916 TGAGGTTGATATTTTACATGCGG - Intergenic
959457294 3:106578537-106578559 TGTGCTTGATGGGTTGGATGGGG + Intergenic
962661683 3:137607702-137607724 TCAGGTTGATTTATTAGATGGGG - Intergenic
967108595 3:186273300-186273322 TGAGATTGATCTATAAAATGTGG + Intronic
972058405 4:34833701-34833723 TGAGCTTATTGAGTTAGATGAGG + Intergenic
972526729 4:39920765-39920787 TGAGCATGTTGTGTTAGATCAGG - Intronic
972868141 4:43259901-43259923 TGAGATTGCTGTATCATATGGGG + Intergenic
974118053 4:57605043-57605065 GGAGCTGGATGTATTATAAGTGG + Intergenic
974450219 4:62045690-62045712 TGAGTTTCATGTATTATTTGGGG + Intronic
975906472 4:79219217-79219239 TGAGCTTGGTCGATTGGATGAGG + Intergenic
976033053 4:80781377-80781399 TGATATTGATATATTAGATGAGG + Intronic
980025858 4:127765615-127765637 TGAGCTCTATGTCTTACATGGGG - Intronic
981651184 4:147060936-147060958 TGAGCTTATTGTCTTAGATGTGG - Intergenic
982322808 4:154097277-154097299 TGAACTTGATATATTGGATGGGG - Intergenic
983577589 4:169275228-169275250 TAAGTTTGATGTAGAAGATGAGG + Intergenic
984146834 4:176071677-176071699 TGAGCTTGTTGAAGTAGATGTGG + Intronic
987084737 5:14457930-14457952 TGAGGTTGATTTATTGGCTGAGG + Intronic
994226843 5:97262579-97262601 TGAGCTTATTGTCTTAGATGAGG - Intergenic
994232331 5:97322091-97322113 TGTGCTTGATGGATTATATTAGG + Intergenic
996286659 5:121802182-121802204 TGAGCTTCATGTGTAAAATGGGG + Intergenic
996388599 5:122935139-122935161 TGAGCTTTATGAAATAAATGAGG - Intronic
997380663 5:133434234-133434256 TTGGTTTGATGGATTAGATGAGG + Intronic
998169129 5:139861949-139861971 CGAGGTGGTTGTATTAGATGAGG + Intronic
998240712 5:140441682-140441704 AAAGCTTGATGTATAACATGAGG + Intronic
999400077 5:151257706-151257728 TGGGCTAAATGTAGTAGATGAGG - Intronic
1004870731 6:19901460-19901482 TTAGCTTTATGTATTATTTGGGG - Intergenic
1007849833 6:44792452-44792474 TTGGCTTGATGTATTGGATGTGG + Intergenic
1010763676 6:79753757-79753779 TTAGTTTGAAGTTTTAGATGAGG - Intergenic
1012730957 6:102879449-102879471 TCACCTTGATGTATTATATTAGG + Intergenic
1012816551 6:104029604-104029626 TGAGCTTGATGTCTTAGCAAAGG + Intergenic
1013232915 6:108173037-108173059 TGTGCTTGATCTTTTAGAAGGGG + Intronic
1013691879 6:112654653-112654675 TGAATTTGATGAATTAAATGAGG + Intergenic
1015175586 6:130304097-130304119 TGATTTTTATGTATTATATGAGG + Intronic
1017389010 6:153918013-153918035 TGATCTTGCTGTATTAGGCGTGG - Intergenic
1020367849 7:7399487-7399509 TGAGCTAGAGGTAATGGATGTGG + Intronic
1025219423 7:57093227-57093249 TGAGCCTGATTTTTTATATGTGG - Intergenic
1025630212 7:63264782-63264804 TGAGCCTGATTTTTTATATGTGG - Intergenic
1027135305 7:75619800-75619822 TGAGCTTTATGTAACAGATGTGG - Intronic
1029262932 7:99315594-99315616 TGGGCTTGCTGTATTAGACATGG + Intergenic
1029954166 7:104620121-104620143 TGATCTTGATATATTACATCAGG - Intronic
1031320932 7:120326004-120326026 TGAGCTTGATAAATGAGAAGTGG + Intronic
1033767173 7:144506262-144506284 AGAAATTGATGTATTAAATGAGG - Intronic
1033883738 7:145918444-145918466 TGAACTTGATGTATTAATTTGGG + Intergenic
1034433082 7:151050627-151050649 TGGGCTTGAAGTAGTAGGTGTGG - Intronic
1035688921 8:1547288-1547310 GGAGCTTGCTGTCCTAGATGTGG + Intronic
1038933031 8:32216781-32216803 TGAACTAGATGTATTAGTTAAGG - Intronic
1039541497 8:38375321-38375343 TTAGCTTGTTTTTTTAGATGTGG - Intronic
1040453414 8:47571977-47571999 TAAGCTTGATCTATTAGAAGAGG - Intronic
1042391791 8:68244443-68244465 TGAGTTTCATGTTTTATATGAGG + Intergenic
1042844082 8:73153296-73153318 TGAGCTCTATTTTTTAGATGGGG + Intergenic
1043728282 8:83640869-83640891 TGAACTTGATCTCTAAGATGAGG - Intergenic
1050774803 9:9246503-9246525 TGAGCTTGATGCATTTTCTGTGG - Intronic
1052430809 9:28364478-28364500 TGTGCTTAATGTCTAAGATGTGG + Intronic
1056614015 9:88146609-88146631 TGATCTTAATCTATTTGATGTGG + Intergenic
1057579945 9:96278860-96278882 CCAGCTTGATGTTTTAGGTGTGG - Intronic
1058638215 9:107057377-107057399 AGAGCATGAAGGATTAGATGTGG + Intergenic
1058917063 9:109577865-109577887 TGAGTTTGATGAATTAGATTAGG + Intergenic
1059185805 9:112269605-112269627 AGTGCTTCATGTTTTAGATGAGG - Intronic
1060470047 9:123940970-123940992 TGATCTCGATGTAATAGCTGAGG - Intergenic
1185926494 X:4152931-4152953 GAAGCTTGATGTATTATAGGAGG + Intergenic
1187260815 X:17683679-17683701 AGAGCTTGTAGTCTTAGATGAGG + Intronic
1187614518 X:20978648-20978670 AGAGCTTCATGTTATAGATGAGG + Intergenic
1188531113 X:31142027-31142049 TGACATTGATATATTAGAAGAGG - Intronic
1188650016 X:32621050-32621072 TGAGCTATATGTATTATCTGTGG - Intronic
1189190367 X:39096611-39096633 TGGTCTTGATTTAGTAGATGTGG - Intergenic
1189194624 X:39142388-39142410 TGGGACTGATGTATTAAATGGGG + Intergenic
1189527135 X:41834897-41834919 TGAGTCTGAAGAATTAGATGGGG - Intronic
1190991822 X:55558981-55559003 TAGACTTGATGTATCAGATGTGG + Intergenic
1193490811 X:82145465-82145487 AAAGCTTGATGGAATAGATGGGG - Intergenic
1194057644 X:89156354-89156376 TTAGCTTGAAGTATAAGATATGG - Intergenic
1195590961 X:106626246-106626268 TAAGCTTAATGGATTAGCTGGGG - Intronic
1196184716 X:112733696-112733718 TAAGGTTGATGTATTGGGTGTGG + Intergenic
1197490831 X:127115539-127115561 TTAGCTAGATGTATCAGTTGTGG + Intergenic
1199230616 X:145433548-145433570 TGTGGTTGATGTATAAAATGAGG - Intergenic
1201758197 Y:17512963-17512985 TGAGCTGGATAGATGAGATGGGG + Intergenic
1201843358 Y:18393027-18393049 TGAGCTGGATAGATGAGATGGGG - Intergenic