ID: 1143397394

View in Genome Browser
Species Human (GRCh38)
Location 17:6612092-6612114
Sequence CAAGCTCACTCTGCAACCTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 174}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143397391_1143397394 11 Left 1143397391 17:6612058-6612080 CCTTCTTCCAGAACTATATCCGC 0: 1
1: 0
2: 0
3: 1
4: 74
Right 1143397394 17:6612092-6612114 CAAGCTCACTCTGCAACCTCTGG 0: 1
1: 0
2: 1
3: 26
4: 174
1143397393_1143397394 -8 Left 1143397393 17:6612077-6612099 CCGCATCTAATACATCAAGCTCA 0: 1
1: 0
2: 0
3: 18
4: 139
Right 1143397394 17:6612092-6612114 CAAGCTCACTCTGCAACCTCTGG 0: 1
1: 0
2: 1
3: 26
4: 174
1143397392_1143397394 4 Left 1143397392 17:6612065-6612087 CCAGAACTATATCCGCATCTAAT 0: 1
1: 0
2: 0
3: 16
4: 97
Right 1143397394 17:6612092-6612114 CAAGCTCACTCTGCAACCTCTGG 0: 1
1: 0
2: 1
3: 26
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143397394 Original CRISPR CAAGCTCACTCTGCAACCTC TGG Exonic
900620874 1:3587188-3587210 CAAGCACACTCTCCACTCTCAGG + Intronic
900764537 1:4494956-4494978 AAACCCCACTCTGCACCCTCAGG - Intergenic
900886187 1:5417128-5417150 CAAGCTCACTCAACAAACACAGG + Intergenic
901668278 1:10838706-10838728 CAAACGCCCTCTGCAGCCTCTGG - Intergenic
902294275 1:15455771-15455793 CAAGGTCACATTGCAACCCCTGG + Intergenic
902297105 1:15475146-15475168 CAAGGTCACACTGCAACCCCTGG + Intronic
903936555 1:26899225-26899247 CTAACTAACTCTGTAACCTCAGG + Intronic
905252201 1:36656669-36656691 TATACTCACTGTGCAACCTCAGG + Intergenic
907769420 1:57445364-57445386 CAAGGTCACACAGCAAGCTCAGG + Intronic
914240228 1:145848238-145848260 CAAGCTCTGGCTGCAACATCTGG + Exonic
917283140 1:173398121-173398143 CAACTTCACTGTCCAACCTCAGG + Intergenic
919721971 1:200847271-200847293 CAGGCTCATTCTTCAGCCTCAGG + Exonic
920936683 1:210441439-210441461 CAATCTTTCTCTGCACCCTCTGG + Intronic
922506339 1:226128152-226128174 GAAGCGCCCTCAGCAACCTCAGG + Intergenic
1063976989 10:11425299-11425321 CAAGTTCATCCTGAAACCTCAGG + Intergenic
1069389360 10:67916465-67916487 CCAGCTCTCTCTGGAACATCAGG - Exonic
1069511947 10:69049004-69049026 CAAGCTCATTCAGGAAGCTCTGG + Intergenic
1074291035 10:112138178-112138200 CACCCTCACTCTGCAGCCACTGG + Intergenic
1075481204 10:122783320-122783342 CAGGCTGACACTGAAACCTCTGG - Intergenic
1077404822 11:2378150-2378172 CCAGCTCACTCTCCAATCTGCGG + Intronic
1080491243 11:32766605-32766627 CAAACTGAATCTGCAAACTCAGG + Intronic
1083659009 11:64243511-64243533 CAAACTCGCTCTGCACCCTCAGG - Intronic
1084120677 11:67067141-67067163 CTGGCTCACCCAGCAACCTCAGG - Intronic
1085971896 11:81602715-81602737 CCATCTCACTCTGCATCTTCAGG + Intergenic
1088576731 11:111279444-111279466 CATGCTCCCTCTGGAGCCTCTGG + Intronic
1088836065 11:113578668-113578690 CAAGCTCAGTCTTCTACCCCAGG + Intergenic
1095970627 12:47899746-47899768 CAGGCTGACTCTGCAGCCTTGGG + Intronic
1100195368 12:92239068-92239090 CAGGCACACTCTTCAGCCTCAGG + Intergenic
1102351556 12:112196162-112196184 CAAACTCACTCTGAACCCACGGG + Intronic
1102828609 12:115973278-115973300 AAAGCTGACTCTGAAACCTAAGG + Intronic
1103530029 12:121594735-121594757 CAAGCGCACACTGCGACCCCTGG - Intergenic
1107816671 13:44250670-44250692 CAAGCACACTCAGCAGCTTCGGG + Intergenic
1110923314 13:81117138-81117160 CAAGTTCAATCTGCGGCCTCTGG - Intergenic
1113086437 13:106574044-106574066 CAAGCTCACACTCCCATCTCAGG - Intergenic
1114194049 14:20461457-20461479 CCAGCTCACTCCGCAACCAGTGG + Exonic
1114735666 14:25041243-25041265 CATGCTCACTCTGCCTCCTGGGG - Intronic
1115552829 14:34519998-34520020 CAAGCTTACTCAGCAGCCTGAGG - Intronic
1119917766 14:78418055-78418077 CAACCTAAATATGCAACCTCAGG - Intronic
1122318904 14:100841556-100841578 CCGGCTCACCGTGCAACCTCGGG - Intergenic
1123108145 14:105852510-105852532 CACGCTCTCTCTGCCACCCCAGG - Intergenic
1126917315 15:53480205-53480227 CAAGCTTATTCTGAAATCTCTGG + Intergenic
1129107849 15:73321584-73321606 CAAGCACACACCGCCACCTCTGG - Exonic
1129951337 15:79594277-79594299 AAATCTCACACTGCAAACTCAGG - Intergenic
1130378607 15:83353007-83353029 CCAGCTCACTCTATGACCTCAGG - Intergenic
1130410679 15:83645737-83645759 AAAGCTCACTGTGCATTCTCCGG - Intergenic
1130981635 15:88815946-88815968 CATGCTCCCTCTGAAACCTATGG + Intronic
1132608664 16:804240-804262 CACGCTCGCGCTGCAGCCTCGGG + Intergenic
1133316097 16:4885006-4885028 CCAGCTCACTCTGGTAGCTCCGG + Exonic
1134363854 16:13558156-13558178 CAAGATCACACAGCAAACTCGGG - Intergenic
1134649958 16:15900498-15900520 AAAGTTCACTTTGAAACCTCTGG - Intergenic
1135209604 16:20513132-20513154 CAAGCTGCCTCTGCAATCTAGGG - Intergenic
1135513159 16:23106031-23106053 CCTGCTCACCCTGCAAACTCAGG + Intronic
1138247064 16:55475640-55475662 CACGCTCCCTCTGAAGCCTCTGG + Intronic
1139556426 16:67713806-67713828 CAGCCCCACTCTGCAACCTCTGG - Intronic
1140591242 16:76355355-76355377 CAAGGTCAATCTGCAACCACTGG - Exonic
1141854629 16:86672717-86672739 CAAGCTCACTGTGCCACCTGTGG - Intergenic
1143397394 17:6612092-6612114 CAAGCTCACTCTGCAACCTCTGG + Exonic
1144021554 17:11242951-11242973 CGAGCTAACTCTGCATCCTCTGG - Intronic
1144390968 17:14792917-14792939 GAAGCTTACTCTGCAACTCCTGG + Intergenic
1148194978 17:45706789-45706811 CCAGCCCACTCTGCATCCTCTGG + Intergenic
1148793740 17:50187500-50187522 CAAGGTCCCTCTGGAGCCTCTGG - Exonic
1148828917 17:50416419-50416441 CAAGCTCTCTCTGCTATATCTGG - Intergenic
1150194036 17:63275565-63275587 CAAGATGACTAAGCAACCTCAGG - Intronic
1150482574 17:65521907-65521929 CATGGTCCCTCTGAAACCTCGGG - Intergenic
1152278114 17:79369757-79369779 CAGGCTCTCTCTGCAGCCTCGGG + Intronic
1152546922 17:81004633-81004655 CAAGCCCACGCTTCAACCGCGGG - Intronic
1153086481 18:1294298-1294320 CAAGCTGAATCAGCAAGCTCAGG + Intergenic
1153998096 18:10459393-10459415 CATGCAAACTTTGCAACCTCTGG + Intronic
1155286087 18:24290538-24290560 CAAGCACACACTGCCACGTCTGG - Intronic
1155600364 18:27538969-27538991 CAAGCTCACACTCCAGCCTTAGG + Intergenic
1155925544 18:31651666-31651688 CATGCTCACTCTTCAACCTGAGG + Intronic
1158225025 18:55192017-55192039 CTGGCTCACTCTGCAATCCCAGG - Intergenic
1158269582 18:55698097-55698119 CAAGCTCACTGGGCATCCACAGG - Intergenic
1161869805 19:6861555-6861577 CTAGCTCTCTCTGCAACCCCAGG + Intergenic
1162123861 19:8488765-8488787 CAGGCTCTCTCGGCCACCTCTGG - Exonic
1164021931 19:21315408-21315430 CAACCTGACTCTGCATCCTTAGG + Intronic
1164069100 19:21749940-21749962 CAATCTGACTCTGCATCCTTGGG + Intronic
1164526784 19:29018814-29018836 CATGCACTCTCTGCAGCCTCAGG - Intergenic
1164744921 19:30604806-30604828 CGAGCTTGCTGTGCAACCTCAGG - Intronic
1164953441 19:32359642-32359664 TAAACTCACTCTGCAACAACAGG - Intronic
1165342626 19:35223745-35223767 CAAGCTCACTGTGTGACCTCAGG + Intergenic
1167574006 19:50309091-50309113 CCAGCTCACGCTGCAGCCTCCGG - Exonic
1167613043 19:50516599-50516621 CACGCTCTCTCTGAAACCTGGGG - Intergenic
1168015383 19:53568803-53568825 CAAGCTCTCAATGAAACCTCAGG - Intronic
924980534 2:215792-215814 CAAGCTCTTCCTTCAACCTCTGG + Intergenic
926404315 2:12535065-12535087 CAAACTCTCTCTGCACCCACGGG + Intergenic
926433773 2:12817529-12817551 CATGCTCCCTCTGAAACCTGTGG - Intergenic
926630871 2:15135300-15135322 CAAACTCACTCTGCTTCCCCAGG - Intergenic
926710500 2:15875662-15875684 CAAGCTCACCCAGCAGCCTATGG - Intergenic
926715325 2:15919662-15919684 CAGACTCCCTCTGAAACCTCTGG + Intergenic
928281661 2:29951802-29951824 GAAGCTGCCTCTGCAACCCCAGG - Intergenic
932553506 2:72796836-72796858 CTAGCTCAATCTGCAACCAGAGG + Intronic
932848079 2:75155293-75155315 CAAGCTCACTTAGCATCATCTGG + Intronic
933940571 2:87241432-87241454 AAAGGTCAGCCTGCAACCTCAGG - Intergenic
935346007 2:102109161-102109183 CAGGCTCACTCTGGAGCCTGTGG + Intronic
937955958 2:127421981-127422003 CAAGCTCACCCTACTACCTAGGG - Intronic
941221489 2:162787261-162787283 CAAGCTCACTCCCCAGACTCAGG + Intronic
941857586 2:170246635-170246657 CATGCTCCCTCTGAAGCCTCTGG - Intronic
945733206 2:213566607-213566629 TAAGCTCACTGTGCAACATCTGG + Intronic
948256860 2:236574695-236574717 TGAGCTCACTCTGCAAGCTGAGG - Intronic
1168935909 20:1665142-1665164 CGAGCTCCCTCTGCACCCTTGGG - Intergenic
1172856256 20:38005334-38005356 CAAGCTCAATCTGGAGCTTCAGG - Intronic
1174140286 20:48408328-48408350 CAAGGACACTCAGCTACCTCAGG + Intergenic
1174387762 20:50197451-50197473 CAAGGTCACTCTGCAACCAAGGG - Intergenic
1174708781 20:52683920-52683942 CAAGCTCACACGGCAACCCCAGG - Intergenic
1175178195 20:57126433-57126455 CAAGCTCACTCAGCAACTTAAGG + Intergenic
1175451479 20:59072443-59072465 CATGCTCCCTCTGAAACCTTCGG - Intergenic
1175840175 20:62021618-62021640 GACACTCACTCGGCAACCTCAGG + Intronic
1176374912 21:6082222-6082244 GGAGCACACTCTGCAGCCTCCGG + Intergenic
1177289740 21:19095949-19095971 CAAACTTCCTCTGCAGCCTCGGG - Intergenic
1178352226 21:31880411-31880433 CATGCTCCCTCTGCAGCCACAGG + Intronic
1178521075 21:33288999-33289021 CAACCTCTCTCTGCCACATCTGG - Intronic
1179748563 21:43456023-43456045 GGAGCACACTCTGCAGCCTCCGG - Intergenic
1179968619 21:44820839-44820861 CAAGCTGATTCTCCAGCCTCAGG - Intergenic
1181444327 22:22957185-22957207 CAAGCTCCTACTGCATCCTCAGG + Intergenic
1182778817 22:32851147-32851169 AAAGCCCACTTTGCAACCTCTGG + Intronic
1184407264 22:44307197-44307219 CTGGCTCACTCTGCCACCTGGGG + Intronic
1184529933 22:45048933-45048955 CAAGCTCACTCTGGCTCCTGGGG + Intergenic
1184751828 22:46490743-46490765 GAAACTCACTCTGCACCCTGTGG - Intronic
949219600 3:1615861-1615883 CAAGCTAACTTTGTCACCTCTGG + Intergenic
952906284 3:38141057-38141079 CAAGCCCAGTCTTCAACCCCAGG - Intronic
957566795 3:81894472-81894494 ACAGCTCACTCTTCAACCTCTGG - Intergenic
957981481 3:87517041-87517063 CAGGCTCCCTCAGAAACCTCTGG + Intergenic
959817926 3:110697882-110697904 CATGCTCCCTCTGGAAACTCAGG + Intergenic
962282778 3:134064942-134064964 CAAGCTGTCTCTGCAACTCCAGG - Intergenic
962807927 3:138939868-138939890 CAGGCTGACCCTGCAACCTCTGG + Intergenic
962974229 3:140432203-140432225 ATAGCTCACTCTGCAACCTTGGG + Intronic
966481620 3:180415650-180415672 GAAGCTCACTCTGCATTGTCTGG + Intergenic
967861135 3:194152761-194152783 CAGGGTCACACTGCAACCTCAGG + Intergenic
968288386 3:197521312-197521334 GGAGCTCTGTCTGCAACCTCGGG - Intronic
969076362 4:4581561-4581583 CAAGCTATCCCCGCAACCTCAGG - Intergenic
971500155 4:27310261-27310283 CAAGCCCACTCATGAACCTCTGG - Intergenic
971922854 4:32965783-32965805 TAAACTCACTCTGCCATCTCAGG + Intergenic
972538728 4:40020912-40020934 CAAGCTCAGACTGCCAGCTCTGG + Intergenic
973264414 4:48197276-48197298 CATGCTCACTCTGCAACCTTGGG + Intronic
974921669 4:68249654-68249676 CAAGCTGACACTGAAACTTCAGG - Intergenic
975101726 4:70521685-70521707 GAGTCTCACTCTGCAACCTCTGG + Intronic
975759126 4:77600779-77600801 CAATCTGATTTTGCAACCTCAGG + Intronic
979671339 4:123363249-123363271 CCAGCTTTCTCTGCAGCCTCCGG - Intergenic
981617534 4:146657130-146657152 CAAACTCAGTGTGCAGCCTCAGG + Intergenic
983536979 4:168868243-168868265 CATGCTCACCCTGCAACCAAGGG + Intronic
983965241 4:173801511-173801533 CACTCTCACTATGCAATCTCAGG - Intergenic
986920945 5:12679638-12679660 CATGCTCCCTCTGAAACCTTAGG + Intergenic
986978021 5:13415106-13415128 CAAGCCAACTGTGCCACCTCTGG + Intergenic
989162994 5:38409594-38409616 TTGGCTCACTCTGCATCCTCAGG - Intronic
989541758 5:42626575-42626597 CAGCCCCACTCTCCAACCTCAGG - Intronic
991931020 5:71752405-71752427 CATTCTCACTGTGAAACCTCTGG - Intergenic
994138764 5:96319281-96319303 CAAGCTCCATCTGCAACATTGGG + Intergenic
994994379 5:107041227-107041249 AAATCTTACTGTGCAACCTCAGG - Intergenic
997799465 5:136845221-136845243 CATGCTCCCTCTGAAGCCTCTGG - Intergenic
999141156 5:149363003-149363025 CTAACTCACTGTGTAACCTCAGG - Intronic
1000565469 5:162841416-162841438 CAATTTCACTCTGTCACCTCAGG - Intergenic
1002659061 5:180778006-180778028 CAAGCTCACTCTAGAACCAGAGG - Intergenic
1003238253 6:4317913-4317935 CAGCCTCACTCTCCATCCTCTGG + Intergenic
1005462510 6:26082670-26082692 CAAGATCCCTCTGTAGCCTCTGG + Intergenic
1007733849 6:43968336-43968358 CAAGCTCTCACTGCAGCCTGAGG - Intergenic
1011096553 6:83672353-83672375 CAATCTCACTCTGCTACTTATGG + Intronic
1011737866 6:90330967-90330989 CAAGCCCGCTCTGCAACTTCCGG - Intergenic
1013380166 6:109561019-109561041 CATGATCTCACTGCAACCTCCGG + Intronic
1016313614 6:142760996-142761018 CAACCTGTCTCTGCAAGCTCAGG + Intronic
1016521946 6:144955449-144955471 CCATCTCACTGTGCTACCTCTGG - Intergenic
1016543022 6:145187921-145187943 CAGCCTCACTTTTCAACCTCTGG - Intergenic
1018154795 6:160975619-160975641 TAAGCTCACTTTGCCACATCAGG + Intergenic
1020237213 7:6365540-6365562 TAAGACCAGTCTGCAACCTCAGG - Intergenic
1024994391 7:55261139-55261161 CAGGCTAACTCTGCAAATTCAGG + Intergenic
1026029442 7:66777326-66777348 CAAACTCATTGTGCAACCTTGGG - Intronic
1031150200 7:118045418-118045440 TGAGCTCCCTCTGCATCCTCAGG + Intergenic
1034370012 7:150586815-150586837 CAAGCTCACTCTCCTCCCTCTGG + Intergenic
1036701979 8:11018994-11019016 CAAGCTCAGCCTTCATCCTCAGG + Intronic
1038896365 8:31786953-31786975 CAACCTCACCCCACAACCTCTGG - Intronic
1040485172 8:47864274-47864296 CACGCTCACTCTGGGAACTCAGG - Intronic
1040730201 8:50435898-50435920 CAAGCCCACTCTCTAATCTCTGG - Intronic
1041386933 8:57314072-57314094 CAAGATCACTCTGTCACCTATGG - Intergenic
1041611643 8:59856851-59856873 CAAGCACACTCTTCAACCACAGG + Intergenic
1042070917 8:64932255-64932277 CAAGCTCACTGTTCAAAATCAGG - Intergenic
1042790839 8:72603966-72603988 CAAGCTTTCTCTGAAAGCTCGGG - Intronic
1045466084 8:102470876-102470898 CAAGGTCACTCTGCACCTTGTGG + Intergenic
1047214656 8:122866418-122866440 CAAGCTCATTCTGTAACTCCAGG - Intronic
1047716788 8:127603019-127603041 TCAGCTCACTCCCCAACCTCTGG - Intergenic
1047772912 8:128044857-128044879 AAGGCTCACTCCGCACCCTCAGG - Intergenic
1050781039 9:9336422-9336444 CAAGATCACTGTGCGACGTCAGG - Intronic
1052013776 9:23442087-23442109 CGAGCTCATTCTGGAAGCTCTGG - Intergenic
1053592258 9:39526399-39526421 CCAGCTCCCTGTGCAGCCTCAGG + Intergenic
1053850109 9:42281740-42281762 CCAGCTCCCTGTGCAGCCTCAGG + Intergenic
1054574045 9:66838886-66838908 CCAGCTCCCTGTGCAGCCTCAGG - Intergenic
1055434335 9:76277160-76277182 CATGATCTCACTGCAACCTCCGG - Intronic
1055758797 9:79584073-79584095 GACTCTCACTATGCAACCTCAGG - Intronic
1056759762 9:89406134-89406156 TTAGCTCTCTCTGCAGCCTCTGG - Intronic
1058216557 9:102240978-102241000 CAACCTCACTCAGCATGCTCAGG - Intergenic
1058875953 9:109245014-109245036 CAAGCAGACTCTGCAGCCCCCGG + Intronic
1059529574 9:115023499-115023521 CAACTTCACTCTGTGACCTCAGG + Intronic
1059664875 9:116437280-116437302 TAAGCTCACTGTGCAACCCTGGG - Intronic
1060439802 9:123627836-123627858 GAAGCTCACTCAGCCCCCTCTGG - Intronic
1060495236 9:124113472-124113494 CTAGCTCCCTCTGCAGCCACAGG - Intergenic
1060732940 9:126049526-126049548 CATTCTCCCTCTCCAACCTCGGG - Intergenic
1060793092 9:126498666-126498688 CCAGCTCACTCTGGGACCTCAGG + Intronic
1061230995 9:129315727-129315749 CAAGCTCGCTCTGCAAACCTGGG - Intergenic
1188016829 X:25115470-25115492 CCAGCTCACTGTGGAACCTTAGG + Intergenic
1188578628 X:31683380-31683402 CATGCTCACTCTGCATTCTTTGG - Intronic
1195958203 X:110356838-110356860 CTTGCTAACTATGCAACCTCAGG - Intronic
1202339165 Y:23842621-23842643 CCAGCTCACTCAGAAACTTCTGG + Intergenic
1202531601 Y:25827451-25827473 CCAGCTCACTCAGAAACTTCTGG - Intergenic