ID: 1143397395

View in Genome Browser
Species Human (GRCh38)
Location 17:6612093-6612115
Sequence AAGCTCACTCTGCAACCTCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 234}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143397393_1143397395 -7 Left 1143397393 17:6612077-6612099 CCGCATCTAATACATCAAGCTCA 0: 1
1: 0
2: 0
3: 18
4: 139
Right 1143397395 17:6612093-6612115 AAGCTCACTCTGCAACCTCTGGG 0: 1
1: 0
2: 1
3: 17
4: 234
1143397392_1143397395 5 Left 1143397392 17:6612065-6612087 CCAGAACTATATCCGCATCTAAT 0: 1
1: 0
2: 0
3: 16
4: 97
Right 1143397395 17:6612093-6612115 AAGCTCACTCTGCAACCTCTGGG 0: 1
1: 0
2: 1
3: 17
4: 234
1143397391_1143397395 12 Left 1143397391 17:6612058-6612080 CCTTCTTCCAGAACTATATCCGC 0: 1
1: 0
2: 0
3: 1
4: 74
Right 1143397395 17:6612093-6612115 AAGCTCACTCTGCAACCTCTGGG 0: 1
1: 0
2: 1
3: 17
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143397395 Original CRISPR AAGCTCACTCTGCAACCTCT GGG Exonic
900861495 1:5235958-5235980 AAGCACCCTCTGCCACCACTGGG + Intergenic
901668277 1:10838705-10838727 AAACGCCCTCTGCAGCCTCTGGG - Intergenic
901770076 1:11525473-11525495 AAGCCCACGCTGCTACCACTCGG - Intronic
901903100 1:12383884-12383906 AGGATCACTCTGCTACCTGTGGG - Intronic
902444294 1:16452157-16452179 AAGCTCATTCTGCACACGCTGGG + Intronic
902450620 1:16494677-16494699 ACGCCCACTCTTCTACCTCTAGG + Intergenic
902502247 1:16918666-16918688 ACGCCCACTCTTCTACCTCTAGG - Intronic
904480363 1:30789495-30789517 AAGTTCACTCTTCAACATCCTGG - Intergenic
904522951 1:31110196-31110218 AGTGGCACTCTGCAACCTCTTGG + Intergenic
905252202 1:36656670-36656692 ATACTCACTGTGCAACCTCAGGG + Intergenic
905970436 1:42137824-42137846 AATCTCACTCTCCAGCCTCTTGG - Intergenic
907594117 1:55703959-55703981 AAGCTCACTCAGCACCAGCTGGG - Intergenic
908112930 1:60915053-60915075 ATGCTCCCTCTGAAACCTGTAGG - Intronic
908894746 1:68885573-68885595 AAGCTCACTATACAACTTTTTGG - Intergenic
909112149 1:71492977-71492999 AAGCTAACTGTGCAACAGCTAGG - Intronic
909453320 1:75823050-75823072 ATGCTCCCTCTGAAACCTATAGG + Intronic
909608815 1:77532302-77532324 AAGCTGCCTCTGCTGCCTCTTGG - Intronic
911095747 1:94053671-94053693 ATGCTCCCTCTGAAACCTGTAGG - Intronic
911741483 1:101390981-101391003 AAGCTCACACTCCCACCCCTTGG + Intergenic
914240229 1:145848239-145848261 AAGCTCTGGCTGCAACATCTGGG + Exonic
914995388 1:152538939-152538961 AAGCTAACTCTGTGACCTCGAGG - Intronic
916512734 1:165487256-165487278 AAGCTGACTCCACAACCTCCAGG + Intergenic
918096606 1:181341353-181341375 AACCTGACAATGCAACCTCTAGG - Intergenic
920971001 1:210743835-210743857 GAGCCCGCTCTGCAACATCTGGG + Intronic
922506340 1:226128153-226128175 AAGCGCCCTCAGCAACCTCAGGG + Intergenic
923018923 1:230147998-230148020 ATGATCACTCAGCAACCTCGAGG + Intronic
924360788 1:243239645-243239667 AAGCTCACTATGAAAGGTCTTGG - Intronic
924686307 1:246294310-246294332 AAGCTAACTCTGCAACATAGTGG - Intronic
1064209648 10:13351468-13351490 ACGCTCCCTCTGAAAGCTCTAGG - Intergenic
1065284497 10:24174545-24174567 ATGCTCCCTCTGAAGCCTCTAGG - Intronic
1065371075 10:24987086-24987108 AACCTCACTCTCCACCCTCCAGG - Intronic
1069511948 10:69049005-69049027 AAGCTCATTCAGGAAGCTCTGGG + Intergenic
1070384198 10:75909390-75909412 AACCTCTCTCTGCATCCTCTTGG + Intronic
1071244995 10:83752607-83752629 AAGCACACAGTGCAAGCTCTTGG + Intergenic
1072236260 10:93456601-93456623 AAGCTCACACAGCAAGCTCGTGG + Intronic
1072786299 10:98285350-98285372 AAGCTCCCTCTGAAGGCTCTAGG - Intergenic
1073553725 10:104427854-104427876 AAGCTCCCTCAGCAACATCGAGG + Intronic
1075058259 10:119236185-119236207 TAGGTCAGTTTGCAACCTCTGGG - Intronic
1075481203 10:122783319-122783341 AGGCTGACACTGAAACCTCTGGG - Intergenic
1076011169 10:126989856-126989878 AATCTCAATCTACAAGCTCTTGG - Intronic
1077047192 11:551845-551867 AAGCTGACCCTGCAGCCCCTCGG + Intronic
1078314273 11:10279492-10279514 AAGCTTACCCTGAAACTTCTTGG + Intronic
1080702398 11:34655068-34655090 AACCTCACCCTGCAACCTACAGG + Intronic
1081461919 11:43279961-43279983 AGGCTCTCTCTGCAGGCTCTAGG + Intergenic
1084744913 11:71163733-71163755 GAGCTCACACTGCAATCTTTTGG - Intronic
1086009067 11:82076897-82076919 AAACCCTCTCTGCTACCTCTTGG - Intergenic
1086448570 11:86893195-86893217 AAGCTCTCTTTGAAAGCTCTAGG - Intronic
1087191288 11:95257239-95257261 AAGCTCCCTCTGAAACCTCTAGG - Intergenic
1088367513 11:109054837-109054859 AGCCTCACTCCTCAACCTCTAGG + Intergenic
1088576732 11:111279445-111279467 ATGCTCCCTCTGGAGCCTCTGGG + Intronic
1089637398 11:119824159-119824181 ATGCTCACACTGCAGCATCTAGG + Intergenic
1089790747 11:120941788-120941810 AGGCTCTCTCTGCAGACTCTAGG - Intronic
1091488486 12:912650-912672 CAGCTCTCTCCACAACCTCTTGG - Exonic
1091769871 12:3144538-3144560 AGGCTCCCTCTGCAGCCTCTAGG - Intronic
1093183750 12:15996382-15996404 ATGCTCCCTCTGAAACCTGTAGG + Intronic
1096505392 12:52089288-52089310 ATGCTCCCTCTGAAACCTGTAGG + Intergenic
1097196467 12:57244814-57244836 AAGCTCACTCTTTAACTCCTAGG - Intronic
1103845915 12:123902025-123902047 ATGCTCCCTCTGAAAGCTCTAGG + Intronic
1104353630 12:128066386-128066408 ACGCTCTCTCTGCAGGCTCTAGG - Intergenic
1104573071 12:129942345-129942367 CAGCTTACTCTTCTACCTCTGGG - Intergenic
1105293634 13:19070605-19070627 CAGCTCCCTCTGGAAGCTCTAGG + Intergenic
1108312122 13:49204172-49204194 AAGCTATCTTTGAAACCTCTTGG - Intronic
1110923313 13:81117137-81117159 AAGTTCAATCTGCGGCCTCTGGG - Intergenic
1111847923 13:93534789-93534811 GAGCTCATTCTGCAACTTCCTGG + Intronic
1112422104 13:99261717-99261739 AATGTCACACTGCAAACTCTGGG - Exonic
1113678797 13:112227408-112227430 AAGCTCCCTCCGCAAACCCTCGG - Intergenic
1114944317 14:27659956-27659978 ATGCTCTCTCTGAAACCTGTAGG - Intergenic
1116735597 14:48686678-48686700 AAGCTCTCTCTTCTACTTCTGGG + Intergenic
1116751700 14:48894315-48894337 ATGCTCTCTCTGAAAGCTCTAGG + Intergenic
1120435132 14:84471869-84471891 ATGCTCCCTCTGAAACCTGTAGG + Intergenic
1122726779 14:103760715-103760737 CAGCTCACTCTCCAGCCTCACGG + Intronic
1122935690 14:104954998-104955020 AAGCCCACTCTTCATCCTGTGGG + Exonic
1123739408 15:23221280-23221302 AAACTCACTTTGAAACTTCTTGG + Intergenic
1124183811 15:27503066-27503088 AGCCTCACTCCCCAACCTCTAGG - Intronic
1124290628 15:28450232-28450254 AAACTCACTTTGAAACTTCTTGG + Intergenic
1124292608 15:28467314-28467336 AAACTCACTTTGAAACTTCTTGG - Intergenic
1125510488 15:40290067-40290089 AATCTCTCTCTTCAACCTGTTGG + Exonic
1127681663 15:61303802-61303824 ATGCTCCCTCTGCAGGCTCTAGG + Intergenic
1129107848 15:73321583-73321605 AAGCACACACCGCCACCTCTGGG - Exonic
1130410678 15:83645736-83645758 AAGCTCACTGTGCATTCTCCGGG - Intergenic
1130682440 15:86008480-86008502 AACTTGACTCTGCAGCCTCTGGG - Intergenic
1130981636 15:88815947-88815969 ATGCTCCCTCTGAAACCTATGGG + Intronic
1131332744 15:91516901-91516923 AAGCTTCCTCTGGATCCTCTTGG + Intergenic
1132009813 15:98266211-98266233 ACCCTCACTCTGCAACAGCTTGG - Intergenic
1133876749 16:9742032-9742054 AAGCTCACTCTCAAAGCTGTTGG - Intergenic
1134427520 16:14165355-14165377 AAGATCACTCAGCCATCTCTGGG - Intronic
1134649957 16:15900497-15900519 AAGTTCACTTTGAAACCTCTGGG - Intergenic
1136114498 16:28086325-28086347 AAGCCCCTTCTGCAAGCTCTGGG - Intergenic
1137605174 16:49782290-49782312 ACCCTCACTCTGCCACTTCTTGG + Intronic
1138247065 16:55475641-55475663 ACGCTCCCTCTGAAGCCTCTGGG + Intronic
1138582533 16:57950948-57950970 AAGCTCTCTCTGCATCCCCCAGG - Intronic
1139257753 16:65559331-65559353 ATGCTCCCACTTCAACCTCTAGG + Intergenic
1139556425 16:67713805-67713827 AGCCCCACTCTGCAACCTCTGGG - Intronic
1140615011 16:76651493-76651515 ACGCTCCCTCTACAGCCTCTAGG - Intergenic
1140997274 16:80273056-80273078 AAGCTCCCTCTGGAGGCTCTTGG - Intergenic
1141518160 16:84560036-84560058 ATGCTCCCTCTGGAAGCTCTAGG + Intergenic
1142884081 17:2902053-2902075 ACGCTCCCTCTGCAGGCTCTAGG + Intronic
1143397395 17:6612093-6612115 AAGCTCACTCTGCAACCTCTGGG + Exonic
1144021553 17:11242950-11242972 GAGCTAACTCTGCATCCTCTGGG - Intronic
1144270947 17:13615538-13615560 ATGCTCCCTCTGAAAGCTCTAGG + Intergenic
1147871747 17:43592421-43592443 CATCTCACTCTGCAACTCCTCGG - Intergenic
1148194979 17:45706790-45706812 CAGCCCACTCTGCATCCTCTGGG + Intergenic
1150751017 17:67862777-67862799 ATGCTCCCTCTGCAGGCTCTAGG + Intronic
1152571696 17:81123897-81123919 TGTCTCACTCTGCAGCCTCTTGG - Intronic
1153160917 18:2203721-2203743 CAGCTCCCTCTGCAAGCCCTGGG - Intergenic
1155177782 18:23315854-23315876 AAGCTCACTCAGGAACTTCATGG + Intronic
1155286086 18:24290537-24290559 AAGCACACACTGCCACGTCTGGG - Intronic
1157827270 18:50823535-50823557 AAGCTCTTTCTGTAGCCTCTTGG + Intronic
1158077967 18:53553225-53553247 ATGCTCCCTCTGCAGGCTCTAGG - Intergenic
1159957431 18:74529860-74529882 AAGCCCACTCTGCGCCCTTTTGG - Intergenic
1160037961 18:75318956-75318978 ATGCTCCCTCTGAAGCCTCTAGG + Intergenic
1164693141 19:30225770-30225792 AAACTCACTTTGCCACCTCCCGG - Intergenic
1164896949 19:31885247-31885269 AAGCTCCCTCTGCAACATGAAGG + Intergenic
1164953440 19:32359641-32359663 AAACTCACTCTGCAACAACAGGG - Intronic
1166178915 19:41093582-41093604 AAGCTCACTCTCCATGCTCTTGG - Intronic
926433772 2:12817528-12817550 ATGCTCCCTCTGAAACCTGTGGG - Intergenic
926715326 2:15919663-15919685 AGACTCCCTCTGAAACCTCTGGG + Intergenic
926785547 2:16515002-16515024 AATCCTACTCTGCAATCTCTAGG - Intergenic
927114834 2:19889652-19889674 ATGCTCCCTCTGAAGCCTCTAGG + Intergenic
927217550 2:20676611-20676633 GAGCTCACGCGGCAACTTCTAGG - Intergenic
927740065 2:25560783-25560805 ACACTCTCTCTGCAAGCTCTAGG - Intronic
928281660 2:29951801-29951823 AAGCTGCCTCTGCAACCCCAGGG - Intergenic
929116755 2:38451190-38451212 AAACTCACTCTGGATTCTCTGGG - Intergenic
930570123 2:53076039-53076061 AAGCTAAATATGCAATCTCTTGG - Intergenic
931908479 2:66868824-66868846 CAGTTCATTCTGCAACCTCTTGG + Intergenic
931943058 2:67274097-67274119 GAGCTCACCCTGCAACCTGCTGG + Intergenic
935233211 2:101117165-101117187 ATGCTCCCTCTGAAACCTGTAGG - Intronic
935346008 2:102109162-102109184 AGGCTCACTCTGGAGCCTGTGGG + Intronic
936088818 2:109488096-109488118 GAGCCCACTCTGCAGGCTCTGGG - Intronic
938677510 2:133653685-133653707 AAGTGAACTCAGCAACCTCTAGG + Intergenic
939264256 2:139851133-139851155 AAGCTCATTCTTCACCCTCGTGG - Intergenic
940168089 2:150797241-150797263 TAGCTCACTCTCAAACCTCCAGG - Intergenic
940484167 2:154275939-154275961 AAGATCACTCTGTAACCTTAAGG + Intronic
940793876 2:158056545-158056567 ATGCTCCCTCTGAAACCTGTAGG + Intronic
941857585 2:170246634-170246656 ATGCTCCCTCTGAAGCCTCTGGG - Intronic
942115560 2:172726032-172726054 ATGCTCCCTCTGAAACCTGTAGG + Intergenic
944511811 2:200472895-200472917 ATGCGCACGCAGCAACCTCTGGG + Exonic
945335550 2:208588617-208588639 ATGCTCCCTCTGAAACCTCTAGG - Intronic
945372378 2:209035180-209035202 AAGCCAACTCTGCAACTTATGGG - Intergenic
946701489 2:222418793-222418815 ATGCTCCCTCTGAAACCTGTAGG + Intergenic
948065799 2:235078213-235078235 AACCTCAGCCTGCAACCTCCAGG - Intergenic
948256859 2:236574694-236574716 GAGCTCACTCTGCAAGCTGAGGG - Intronic
948351939 2:237347882-237347904 AAGCTTACTGTGCCACTTCTCGG - Intronic
948633962 2:239322202-239322224 AAGCTCAGCCTGCAACCAATCGG + Intronic
1170476705 20:16722145-16722167 ATGCTCTCTCTGAAAGCTCTAGG - Intergenic
1171183811 20:23110732-23110754 GCGCTCACTCTGAAGCCTCTAGG + Intergenic
1171878229 20:30598002-30598024 CAGCTCCCTCTGGAAGCTCTAGG + Intergenic
1172536752 20:35679659-35679681 AAAAACACTCTACAACCTCTGGG + Intronic
1172565448 20:35926852-35926874 AAGCTCACTGTCCACCTTCTAGG + Intronic
1173034868 20:39399065-39399087 TAGCTCACTGTGGAACCCCTGGG - Intergenic
1173076507 20:39824488-39824510 AACCTCATTCTCCATCCTCTGGG + Intergenic
1173735158 20:45355645-45355667 AAGCTAAATGTTCAACCTCTAGG - Intergenic
1175178196 20:57126434-57126456 AAGCTCACTCAGCAACTTAAGGG + Intergenic
1177943903 21:27443956-27443978 ATGCTCTCTCTGAAACCTGTAGG - Intergenic
1178013742 21:28318132-28318154 AAGCTCACAGTGCAAGCTGTCGG - Intergenic
1178027287 21:28482779-28482801 ATGCTCCCTCTGAAACCTGTAGG - Intergenic
1181915359 22:26275571-26275593 TAACTCACTCTGCAGCCTTTGGG - Intronic
1182051706 22:27317351-27317373 GTGCTCCCTCTGCAGCCTCTAGG - Intergenic
1182753271 22:32658374-32658396 CAGCTCACTCTGCAGCCTGCTGG - Intronic
1183063474 22:35349042-35349064 AAGCTCCCTCTGCCACATCCAGG + Intergenic
1184993341 22:48185061-48185083 ACGCTCCCTCTGAAACCTCCAGG - Intergenic
949219601 3:1615862-1615884 AAGCTAACTTTGTCACCTCTGGG + Intergenic
953268623 3:41417590-41417612 AGGCTGACTCTGCAAACCCTGGG + Intronic
955000508 3:54923104-54923126 AAGGTCACTCTGTAGACTCTTGG - Intronic
955349810 3:58185059-58185081 AAGCTTTCTCTGAAACCTATAGG + Intergenic
957981482 3:87517042-87517064 AGGCTCCCTCAGAAACCTCTGGG + Intergenic
959620366 3:108393291-108393313 AGCCCCACTCTGCAAGCTCTGGG + Intronic
959620992 3:108398337-108398359 ATGCTCCCTCTGAAACCTGTAGG - Intronic
960411291 3:117328835-117328857 ATGTTCCCTCTGAAACCTCTAGG - Intergenic
962184877 3:133247665-133247687 AATCCCTCTCTGCAACCCCTGGG + Intronic
963199647 3:142572966-142572988 AAGCACAGTCTGCCACCTGTAGG - Intronic
963286620 3:143439891-143439913 AAGCTCAGGCACCAACCTCTGGG + Intronic
967719008 3:192795401-192795423 AAGATCACTCTACAAATTCTTGG - Intergenic
968288385 3:197521311-197521333 GAGCTCTGTCTGCAACCTCGGGG - Intronic
969211811 4:5693537-5693559 ACGCTCCCTCTGCAGGCTCTAGG - Intronic
969676906 4:8619390-8619412 GACTTCATTCTGCAACCTCTGGG + Exonic
969912633 4:10459783-10459805 ATGCTCCCTCTGAACCCTCTAGG - Intergenic
972538729 4:40020913-40020935 AAGCTCAGACTGCCAGCTCTGGG + Intergenic
975789364 4:77932129-77932151 AAACTCAATCTGCCACTTCTGGG + Intronic
979357910 4:119727554-119727576 ATGCTCCCTCTGGAAGCTCTAGG + Intergenic
979524830 4:121705900-121705922 AAGCTCACGGTGCAAATTCTTGG - Intergenic
981521595 4:145668092-145668114 ATGCTCCCTCTGAAACCTATAGG - Intergenic
983129414 4:163996877-163996899 ATGCTCACTCTGAAAGCACTAGG - Intronic
983141698 4:164157583-164157605 ACGCTCGCTCTGAAACCTGTAGG + Intronic
983668888 4:170213515-170213537 AATCTCCCTCTGGAACCTGTAGG + Intergenic
985655767 5:1130685-1130707 AAGCTCCCGCTGCTCCCTCTGGG - Intergenic
987327458 5:16825361-16825383 ACGCCCACCCTGGAACCTCTTGG + Intronic
989116503 5:37958966-37958988 AGGCTCCCACTGAAACCTCTAGG - Intergenic
989923586 5:49841758-49841780 AAGCTTTCTCAGCAACTTCTTGG + Intergenic
989932531 5:49974103-49974125 AAGCTTTCTCAGCAACTTCTTGG + Intergenic
990622052 5:57570638-57570660 CGGCCCACTCTGCAACCTTTTGG - Intergenic
994994378 5:107041226-107041248 AATCTTACTGTGCAACCTCAGGG - Intergenic
995906632 5:117132062-117132084 ATGCTCCCTCTGAAGCCTCTAGG + Intergenic
997799464 5:136845220-136845242 ATGCTCCCTCTGAAGCCTCTGGG - Intergenic
998752564 5:145339470-145339492 AATGTCTCTGTGCAACCTCTAGG - Intergenic
1001215309 5:169850589-169850611 AAGCTCACAATGCCACCTTTTGG - Intronic
1003238254 6:4317914-4317936 AGCCTCACTCTCCATCCTCTGGG + Intergenic
1003644318 6:7902155-7902177 ATGCTCCCTCTGAAACCTGTAGG - Intronic
1005278405 6:24244452-24244474 AAGCTCACACAGCTGCCTCTGGG + Intronic
1005462511 6:26082671-26082693 AAGATCCCTCTGTAGCCTCTGGG + Intergenic
1005488445 6:26323404-26323426 AAGCTCCCACGGGAACCTCTTGG + Intergenic
1006726948 6:36206229-36206251 ACCCTCCCTCTACAACCTCTTGG - Intronic
1007466884 6:42058802-42058824 ATGCTCCCTCTGAAACCTGTAGG + Intronic
1007619248 6:43201946-43201968 AAGCTCACTCTGGCAACTATGGG + Intronic
1010275281 6:73961965-73961987 ATGCTCACTCTGAACCCTCTAGG - Intergenic
1010977213 6:82329410-82329432 ATGCTCCCTCTGAAACCTGTAGG - Intergenic
1011709512 6:90037997-90038019 ATGCTCCCTCTGAAACCTATAGG - Intronic
1014723655 6:124950046-124950068 AGGCTCCCTCTGAAACCTGTAGG - Intergenic
1015312215 6:131778527-131778549 GAGCTCCCTCTGCTCCCTCTAGG + Intergenic
1015757823 6:136626088-136626110 CAGATCGCTCTGCAAACTCTTGG + Intronic
1015921591 6:138271343-138271365 AAGCTGACTCTGAAATATCTTGG + Intronic
1016543021 6:145187920-145187942 AGCCTCACTTTTCAACCTCTGGG - Intergenic
1016942098 6:149490971-149490993 ATGCTCGCTCTGAAGCCTCTAGG - Intergenic
1018003469 6:159599751-159599773 ATGCTCCCTCTGAATCCTCTAGG + Intergenic
1020396179 7:7721133-7721155 AAGCTCTCTCTGAAGTCTCTAGG - Intronic
1022908890 7:34881295-34881317 AAGCTCCCTCTGAAGTCTCTAGG + Intergenic
1025294039 7:57761484-57761506 AGACTCACCCTGCACCCTCTAGG - Intergenic
1026315617 7:69224747-69224769 AAGCCCAGACTGCATCCTCTAGG - Intergenic
1032560379 7:132884676-132884698 GAGCTTACTCTGCAACCTCATGG + Intronic
1032757105 7:134901673-134901695 ATGCTCCCTCTGAAACCTGTAGG + Intronic
1033327602 7:140392430-140392452 AAGCTCACTCCCCAGCCTCTCGG + Intronic
1034404744 7:150895980-150896002 ACGCTCCTTCTGCAACCTCTAGG - Intergenic
1034527838 7:151676986-151677008 ACGCTCTCTCTGAAACCTGTAGG - Intronic
1036179771 8:6574258-6574280 ATGCTCCCTCTGAAACCTATAGG + Intronic
1038043782 8:23749140-23749162 GAGCTCCCTCTGCAGGCTCTTGG - Intergenic
1038440380 8:27567310-27567332 AAACTCACTCTGCTTTCTCTTGG + Intergenic
1038896364 8:31786952-31786974 AACCTCACCCCACAACCTCTGGG - Intronic
1040118630 8:43654887-43654909 AATGTCACTTTGCAACATCTAGG - Intergenic
1041386932 8:57314071-57314093 AAGATCACTCTGTCACCTATGGG - Intergenic
1047716787 8:127603018-127603040 CAGCTCACTCCCCAACCTCTGGG - Intergenic
1050291701 9:4162024-4162046 AGGCTCTCTCTGTAGCCTCTAGG + Intronic
1051686622 9:19664855-19664877 ATGCTCACTCTGAAGGCTCTAGG - Intronic
1052013775 9:23442086-23442108 GAGCTCATTCTGGAAGCTCTGGG - Intergenic
1052800898 9:32967224-32967246 AAAGTCACTCTGCTACCACTGGG - Intergenic
1057266799 9:93622627-93622649 CAGCTCCCTCTGGAAGCTCTAGG - Intronic
1058288527 9:103209763-103209785 AAGCACACGGTGCAACCTGTTGG + Intergenic
1058651439 9:107178823-107178845 ATGCTCCCTCTGACACCTCTAGG + Intergenic
1059408955 9:114119981-114120003 AGGGTCACTCAGCAAGCTCTTGG - Intergenic
1060256680 9:122036882-122036904 AAGCAGACTCTTAAACCTCTAGG - Intronic
1061396410 9:130346221-130346243 GGGCTCACGCTGCGACCTCTGGG + Intronic
1186054440 X:5633856-5633878 AAGCTGACTCTGCAAAGTCATGG - Intergenic
1187564362 X:20433874-20433896 ATGCTCCCTCTGAAACCTGTAGG + Intergenic
1189182150 X:39014800-39014822 AAGGTCTTTCTGCAACCTCCTGG + Intergenic
1189302793 X:39964714-39964736 AAATTCTCTCTGCTACCTCTGGG + Intergenic
1190285783 X:48960492-48960514 GAGCTCACTCTCCAACCTCCAGG + Intergenic
1190372217 X:49753602-49753624 ATGCTCCCTCTGAAATCTCTAGG - Intergenic
1193068316 X:77280941-77280963 ATTCTCATTCTGCTACCTCTGGG - Intergenic
1195634951 X:107103476-107103498 ATGCTCTCTCTGCAGGCTCTAGG - Intronic
1195742087 X:108075170-108075192 GAGCTCAATCTCCAACTTCTAGG + Intronic
1196004972 X:110826161-110826183 AAGTTCCCTCTGTAACCTGTAGG - Intergenic
1197054887 X:122105822-122105844 AATCTCACTCTACAACTTCTAGG + Intergenic
1197173078 X:123456064-123456086 AAGCCCACTATGGCACCTCTTGG + Intronic
1197400058 X:125979224-125979246 AGGCTCACTGTGCAAGCTGTTGG + Intergenic