ID: 1143397396

View in Genome Browser
Species Human (GRCh38)
Location 17:6612100-6612122
Sequence CTCTGCAACCTCTGGGTCTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62298
Summary {0: 1, 1: 0, 2: 42, 3: 3186, 4: 59069}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143397391_1143397396 19 Left 1143397391 17:6612058-6612080 CCTTCTTCCAGAACTATATCCGC 0: 1
1: 0
2: 0
3: 1
4: 74
Right 1143397396 17:6612100-6612122 CTCTGCAACCTCTGGGTCTCCGG 0: 1
1: 0
2: 42
3: 3186
4: 59069
1143397393_1143397396 0 Left 1143397393 17:6612077-6612099 CCGCATCTAATACATCAAGCTCA 0: 1
1: 0
2: 0
3: 18
4: 139
Right 1143397396 17:6612100-6612122 CTCTGCAACCTCTGGGTCTCCGG 0: 1
1: 0
2: 42
3: 3186
4: 59069
1143397392_1143397396 12 Left 1143397392 17:6612065-6612087 CCAGAACTATATCCGCATCTAAT 0: 1
1: 0
2: 0
3: 16
4: 97
Right 1143397396 17:6612100-6612122 CTCTGCAACCTCTGGGTCTCCGG 0: 1
1: 0
2: 42
3: 3186
4: 59069

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143397396 Original CRISPR CTCTGCAACCTCTGGGTCTC CGG Exonic
Too many off-targets to display for this crispr