ID: 1143397398

View in Genome Browser
Species Human (GRCh38)
Location 17:6612114-6612136
Sequence GGTCTCCGGAAGCTCCGTAT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 25}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143397393_1143397398 14 Left 1143397393 17:6612077-6612099 CCGCATCTAATACATCAAGCTCA 0: 1
1: 0
2: 0
3: 18
4: 139
Right 1143397398 17:6612114-6612136 GGTCTCCGGAAGCTCCGTATCGG 0: 1
1: 0
2: 0
3: 0
4: 25
1143397392_1143397398 26 Left 1143397392 17:6612065-6612087 CCAGAACTATATCCGCATCTAAT 0: 1
1: 0
2: 0
3: 16
4: 97
Right 1143397398 17:6612114-6612136 GGTCTCCGGAAGCTCCGTATCGG 0: 1
1: 0
2: 0
3: 0
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143397398 Original CRISPR GGTCTCCGGAAGCTCCGTAT CGG Exonic
902551512 1:17222320-17222342 GGTCTCTGGAAGCTCCGGGGTGG + Exonic
920749247 1:208658506-208658528 GGTCTCCTGAAGCTCTATCTAGG - Intergenic
921681244 1:218034690-218034712 GGTCACCGTAAGCTCCTTAATGG + Intergenic
1065801238 10:29354917-29354939 GTTCTCCAGAAGCTGCCTATGGG + Intergenic
1067214838 10:44293223-44293245 GGCCCACGGAAGCTCCGTGTTGG + Intronic
1081187709 11:40065090-40065112 GGCCTCCTGAAACTCTGTATGGG + Intergenic
1089216676 11:116838170-116838192 GGTCTCCGAAACCTCAGTCTGGG - Intergenic
1122717844 14:103706114-103706136 GGTCTCCTGAGCCTCCGTGTCGG - Intronic
1136377082 16:29872096-29872118 GGTCTCTGGAATCTCTGTCTTGG - Intronic
1143397398 17:6612114-6612136 GGTCTCCGGAAGCTCCGTATCGG + Exonic
946783285 2:223215418-223215440 GGACTCCAGAAGATCCTTATAGG - Intergenic
948152569 2:235755859-235755881 GGTCTCCGGAAGGTCAGGAAGGG + Intronic
1168840941 20:909849-909871 GGGCTCCAGAAGCTCAGTCTGGG - Intronic
1172794412 20:37527306-37527328 GGTCTCCTGAGGCTCCGCTTCGG - Intronic
1177894583 21:26844601-26844623 GGTTTCCGGAAGCGGCGTCTCGG + Exonic
1184512368 22:44941231-44941253 GGTCTCTGGAATCTCCCTCTGGG - Intronic
992885508 5:81155631-81155653 GGTCTGGGGTAGCTCCTTATGGG - Intronic
1000817142 5:165937243-165937265 GATCTCAGGAAGCTTCTTATTGG - Intergenic
1004280531 6:14276073-14276095 TGTCTCCGGGAGCTCCCTGTGGG - Intergenic
1006915252 6:37589761-37589783 GGGCTCCGCAAGCTCCATGTGGG + Intergenic
1034010133 7:147520839-147520861 GGTCTACGGAAGCTGAGCATGGG - Intronic
1038506594 8:28090225-28090247 GGTCTCCTGAAGCTTCGGCTGGG - Intronic
1040482921 8:47842451-47842473 GCTCTCCTGAGGCTCTGTATAGG - Intronic
1058276642 9:103049967-103049989 GGTCTGGGGAAGGTCCATATTGG + Intergenic
1186801061 X:13092734-13092756 GCTCTGAGGAAGCTCCGTCTGGG + Intergenic
1189194477 X:39141070-39141092 GGACTCAGGAAGCTCCATCTAGG + Intergenic