ID: 1143397399

View in Genome Browser
Species Human (GRCh38)
Location 17:6612115-6612137
Sequence GTCTCCGGAAGCTCCGTATC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 31}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143397392_1143397399 27 Left 1143397392 17:6612065-6612087 CCAGAACTATATCCGCATCTAAT 0: 1
1: 0
2: 0
3: 16
4: 97
Right 1143397399 17:6612115-6612137 GTCTCCGGAAGCTCCGTATCGGG 0: 1
1: 0
2: 0
3: 1
4: 31
1143397393_1143397399 15 Left 1143397393 17:6612077-6612099 CCGCATCTAATACATCAAGCTCA 0: 1
1: 0
2: 0
3: 18
4: 139
Right 1143397399 17:6612115-6612137 GTCTCCGGAAGCTCCGTATCGGG 0: 1
1: 0
2: 0
3: 1
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143397399 Original CRISPR GTCTCCGGAAGCTCCGTATC GGG Exonic
900131884 1:1090740-1090762 GTCTCCGGAGGCTCTCCATCAGG + Intronic
900571233 1:3359384-3359406 GTCTCTGGAAGCTCTGCCTCAGG - Intronic
901405246 1:9040757-9040779 GTCTCAGGGAGCTCCATAGCAGG - Intronic
906962955 1:50430536-50430558 TGCGGCGGAAGCTCCGTATCTGG - Intergenic
1071141089 10:82510232-82510254 GCCTCTGGAAGCTCAGTCTCTGG - Intronic
1075552049 10:123400073-123400095 GTCTCTAGATGCTCGGTATCTGG - Intergenic
1077081965 11:728295-728317 GTCCCCGGATGCTCCGCACCAGG - Intergenic
1083681588 11:64354128-64354150 CCCTCAGGAAGCTCCGTCTCCGG - Exonic
1107240817 13:38231646-38231668 TTCTCTGGAAGCTCTGTACCAGG - Intergenic
1108420210 13:50240770-50240792 GTTTCCTTAAGCTCCTTATCAGG - Intronic
1114587333 14:23826621-23826643 TTATCCAGAAGCTCCGTACCTGG - Intergenic
1122717843 14:103706113-103706135 GTCTCCTGAGCCTCCGTGTCGGG - Intronic
1128843286 15:70867963-70867985 TGCTCCGGCAGCTCCGTTTCTGG + Intronic
1140640522 16:76966778-76966800 GCCTCAGGAAGCTCCTAATCAGG - Intergenic
1143397399 17:6612115-6612137 GTCTCCGGAAGCTCCGTATCGGG + Exonic
1149638637 17:58189544-58189566 GTCTCCAGTGGCCCCGTATCTGG + Intergenic
1150448437 17:65245645-65245667 GCCTCAGGAAGCTCCCAATCAGG + Intergenic
1151459818 17:74247891-74247913 CTCTCGGGAAGCTCTGTATCTGG + Intronic
938950754 2:136252271-136252293 GTCTCTGGAACCTCACTATCTGG + Intergenic
944827066 2:203494733-203494755 CTCACCGCAAGCTCCGTCTCCGG - Intronic
1170895945 20:20414422-20414444 CTCTGCGGAAGCCACGTATCTGG + Intronic
1174110207 20:48193559-48193581 CTCCCCGGCAGCTCCGTCTCAGG + Intergenic
979178187 4:117691782-117691804 CTCTCCAGAAGCTTCCTATCTGG + Intergenic
987309724 5:16670723-16670745 CTGTCCGGAAGCTCCGCCTCAGG + Exonic
988297972 5:29390725-29390747 GCCTCCGGCATCTCCGTTTCAGG + Intergenic
996569868 5:124921550-124921572 GTCTGGGGAAGAACCGTATCTGG - Intergenic
1000831148 5:166102764-166102786 TCCTCCGGAAGCTTCGTCTCAGG + Intergenic
1018935369 6:168270758-168270780 GTCTCTGGAGGCTCCGTGCCAGG + Intergenic
1020122026 7:5509923-5509945 GTCTCCGGAAGCTAAGTTCCAGG - Intronic
1020548643 7:9568931-9568953 GTCTCAGGACACTCCGTCTCAGG + Intergenic
1029253557 7:99253572-99253594 GTCCCCGGAGGCTGCGTGTCTGG + Intergenic
1035120241 7:156560691-156560713 ATCTCTGGAAGCTCACTATCTGG - Intergenic
1193933121 X:87581489-87581511 GTCTCTGGAAGCTCTGTCCCAGG - Intronic