ID: 1143401880

View in Genome Browser
Species Human (GRCh38)
Location 17:6651617-6651639
Sequence ATCCCACAGTGCCCCGGGAC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 124}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143401880_1143401891 17 Left 1143401880 17:6651617-6651639 CCGGTCCCGGGGCACTGTGGGAT 0: 1
1: 0
2: 1
3: 14
4: 124
Right 1143401891 17:6651657-6651679 CGCCCATCCCCGACCAGCCCTGG 0: 1
1: 0
2: 3
3: 41
4: 404
1143401880_1143401892 18 Left 1143401880 17:6651617-6651639 CCGGTCCCGGGGCACTGTGGGAT 0: 1
1: 0
2: 1
3: 14
4: 124
Right 1143401892 17:6651658-6651680 GCCCATCCCCGACCAGCCCTGGG 0: 1
1: 0
2: 1
3: 33
4: 270
1143401880_1143401889 -9 Left 1143401880 17:6651617-6651639 CCGGTCCCGGGGCACTGTGGGAT 0: 1
1: 0
2: 1
3: 14
4: 124
Right 1143401889 17:6651631-6651653 CTGTGGGATATGGGGCGGGGCGG 0: 1
1: 0
2: 1
3: 41
4: 438
1143401880_1143401895 22 Left 1143401880 17:6651617-6651639 CCGGTCCCGGGGCACTGTGGGAT 0: 1
1: 0
2: 1
3: 14
4: 124
Right 1143401895 17:6651662-6651684 ATCCCCGACCAGCCCTGGGATGG 0: 1
1: 0
2: 0
3: 16
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143401880 Original CRISPR ATCCCACAGTGCCCCGGGAC CGG (reversed) Exonic
900366737 1:2314713-2314735 GGCCCCCAGTGCCCCCGGACTGG - Intergenic
900524147 1:3120290-3120312 ATCTTCCAGTGCCCCGGGAGGGG - Intronic
902581003 1:17407543-17407565 CTCCCACAGGGCCTTGGGACTGG + Exonic
904822488 1:33255365-33255387 AGCGCACAGTCCCCCGGGAAGGG - Intergenic
913042493 1:115041033-115041055 ATTCCCCTCTGCCCCGGGACTGG - Intergenic
915850211 1:159313846-159313868 GTCCCAGAGTTCCCTGGGACAGG - Exonic
920531345 1:206704912-206704934 ATCACAGAGTGTCTCGGGACTGG - Intronic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
1064392466 10:14953857-14953879 AGCCCCCAGCGCCCCGGGAGCGG + Intronic
1066579733 10:36867102-36867124 ATCTCACAGTTCCCTGGGTCAGG - Intergenic
1067815861 10:49476528-49476550 ATCCCACAGTCCCCAAAGACTGG + Intronic
1071097649 10:81997329-81997351 ATCCCATAGTGACCCTGCACAGG - Intronic
1075783610 10:125033208-125033230 ATCCCACTGTGCCCCAGCGCTGG + Intronic
1076586897 10:131555566-131555588 ATCCCTCAGTGTCCCCGCACTGG - Intergenic
1076668896 10:132108361-132108383 AATCCACTGTCCCCCGGGACTGG - Intronic
1078699487 11:13668018-13668040 GGCCCACAGTCCCCTGGGACTGG + Intergenic
1081007124 11:37758451-37758473 ATCCTACAGTGCAATGGGACAGG + Intergenic
1083005628 11:59343172-59343194 ATCCCACCGTACCTCAGGACAGG + Intergenic
1083393826 11:62374691-62374713 TTCCCACAGGGCCTTGGGACTGG - Intronic
1085770548 11:79321866-79321888 TTCCCACAATGCACAGGGACAGG - Intronic
1088912073 11:114199338-114199360 ATGCCGCTGGGCCCCGGGACGGG + Intronic
1088912086 11:114199375-114199397 ATGCCGCTGGGCCCCGGGACGGG + Intronic
1089294085 11:117457700-117457722 GTCGCCCAGTGCCCGGGGACTGG - Intronic
1094091946 12:26660399-26660421 ATCTCACACTGCCATGGGACTGG + Intronic
1096717740 12:53501278-53501300 ATCCCAGCGTGCCCCGCGGCGGG + Exonic
1098426606 12:70371406-70371428 CTCCTACAGTGCACTGGGACAGG - Intronic
1103918839 12:124389200-124389222 AGCCCACAGACCCCCGGGCCGGG + Intronic
1105049636 12:133037227-133037249 TTCCCACAGTGCCCCGCGTCCGG - Intergenic
1105837582 13:24224355-24224377 AGCCCCCAGAGCCCCGGGGCAGG + Exonic
1105916619 13:24922865-24922887 TTCCCACAGGACCTCGGGACGGG - Exonic
1106336916 13:28791752-28791774 ATTGTACAGTCCCCCGGGACAGG - Intergenic
1108106353 13:47014701-47014723 TTGCCACAGTGCCCCAGGACTGG + Intergenic
1117546598 14:56798420-56798442 GGCCCACAGCGCCCTGGGACCGG + Intergenic
1121317628 14:92971617-92971639 ATGCCACAATGCCCAGGGCCAGG + Intronic
1121413224 14:93762122-93762144 ATCCCACAGGGTCCCAGGACTGG - Intronic
1121546721 14:94768699-94768721 CTCCCCGGGTGCCCCGGGACTGG - Intronic
1127258025 15:57307585-57307607 ATCCCAGTGTGGCCCTGGACGGG + Intergenic
1129165406 15:73774424-73774446 ATCCCACAGGGCCCCAATACAGG - Intergenic
1132552126 16:557862-557884 ATCCCACCCTGCACTGGGACTGG + Intergenic
1132581773 16:688080-688102 CTCCCACAGGGCCACGGGAGTGG - Intronic
1132976437 16:2713465-2713487 ATCCCACCCTGCCCTGGGCCTGG + Intronic
1133273742 16:4624756-4624778 TTCCCGACGTGCCCCGGGACCGG + Intronic
1133988204 16:10684537-10684559 AACCCCAAGGGCCCCGGGACTGG - Intronic
1136489622 16:30598336-30598358 ATCCCACATTGCCCCTGCAGGGG - Intergenic
1136506088 16:30704206-30704228 GTGCCACAGTGCCCCTGGAGGGG + Exonic
1137267935 16:46884215-46884237 GTCCCACAGCGCCCCGCGCCGGG - Intergenic
1137701934 16:50503682-50503704 ATCCCACAGGGCCCCAGGGAGGG + Intergenic
1141822996 16:86460499-86460521 ATCCCACAGAGCTCCGAAACTGG - Intergenic
1142129951 16:88427924-88427946 ACCCCCCAGGGCCCTGGGACTGG + Exonic
1142547494 17:714875-714897 ATCCCACAGTTCCCCGGTCCCGG - Intronic
1143090320 17:4446065-4446087 TGCCCACGATGCCCCGGGACAGG - Exonic
1143401880 17:6651617-6651639 ATCCCACAGTGCCCCGGGACCGG - Exonic
1143881789 17:10035506-10035528 TTCCCACAGTGCCAGGGGAAGGG - Intronic
1144610184 17:16704538-16704560 AGCACACAGTGCCACGAGACAGG - Intronic
1144902562 17:18610883-18610905 AGCACACAGTGCCACGAGACAGG + Intergenic
1144928500 17:18835094-18835116 AGCACACAGTGCCACGAGACAGG - Intergenic
1145129929 17:20335218-20335240 AGCACACAGTGCCACGAGACAGG - Intergenic
1146587082 17:34091553-34091575 TTCCCAAAGTGCTCCGTGACAGG + Intronic
1148751094 17:49946327-49946349 AACCCACAGTGCCCTGAGGCAGG - Intergenic
1152816525 17:82411425-82411447 ATCCCACCGTGCTCAGGGACAGG + Intronic
1152938667 17:83154493-83154515 CTCCCACAGAGCCCTGGGCCTGG + Intergenic
1161533209 19:4802870-4802892 ATCCCCAAGTGCCCCTGGGCGGG - Intergenic
1162246699 19:9407228-9407250 ATCCCAGCGTCCCCCGGGAAAGG + Intergenic
1162918078 19:13884909-13884931 CTCCCAGAGGGCCCCGGGTCTGG - Intronic
1165830661 19:38728774-38728796 AGCCCCCAGTGCCCCAGGCCGGG - Intronic
1166780684 19:45340968-45340990 ATCCCGGAGAGCCCCAGGACGGG - Intronic
1167271719 19:48509976-48509998 ATCCCATGGTGTCCCGGGAAAGG - Intronic
1168159763 19:54502437-54502459 ATCCTACAGTGCGCCGGGCGCGG - Intronic
925738837 2:6987308-6987330 ATCCAACACTGCCCCGGGTGTGG - Intronic
927830445 2:26345807-26345829 ATCCCACCTTCCCCCGGGACCGG + Intronic
928291369 2:30040440-30040462 ATCCCACAGTGGGCCTGGCCAGG + Intergenic
929158777 2:38811311-38811333 GTCCCACAGTGCCATGGGAAAGG - Intronic
929999950 2:46854563-46854585 ATCCCACACTGCCTGGGGAAAGG - Intronic
933724842 2:85420865-85420887 TCCCCACAGTGGCCCGGGACGGG + Intronic
933952336 2:87341852-87341874 ATCCCACAGCACCCGGAGACGGG + Intergenic
935649360 2:105369129-105369151 ATGCCACAGTCCCCAGGGATTGG - Intronic
936519737 2:113204229-113204251 AACCCACAGTGGCCTGGGCCAGG + Intronic
940348641 2:152656055-152656077 ATCCTACAGTGCCCTGTGAAAGG + Exonic
948592592 2:239060815-239060837 ATCCCACACGGGCCCGGGCCGGG - Intronic
948677493 2:239607334-239607356 ACCCAACAGTGCCCGTGGACTGG - Intergenic
948992274 2:241561221-241561243 ATGCCACAGGGCCCTGGGATTGG - Intronic
1170477831 20:16733863-16733885 ATCCCACAGTTTCCTGGGATAGG - Intronic
1171210301 20:23311222-23311244 TTCCCACAGAGCCCGGGGAGGGG + Intergenic
1172445883 20:34993221-34993243 ATCCCACAGTGCCCCGACCTTGG - Exonic
1173531515 20:43773115-43773137 CTCCCACAGTCCCCCAGGGCAGG - Intergenic
1174151521 20:48489466-48489488 ATCCCACACAGCCCAGGGCCAGG + Intergenic
1174806538 20:53608538-53608560 CTCCCACAGGGCCCGGAGACTGG + Intronic
1175401156 20:58700854-58700876 ATCCCACACTGGCCAGGGGCAGG + Intronic
1181275354 22:21684596-21684618 ATGCCACAGTGCCCCGCTACAGG - Intronic
1183068613 22:35380956-35380978 ACCCCACACTGGCCCGGGGCGGG + Exonic
949581474 3:5392730-5392752 AACCCACAGTGCCAAGAGACGGG - Intergenic
952887623 3:38021274-38021296 ATCTCAGAGTGCCCAGGGTCTGG + Intronic
953058476 3:39406940-39406962 TTCCCAGAGTGCCCCGGGAGCGG + Intronic
954157335 3:48693727-48693749 TTCCCACAGTGCCCCCACACGGG + Intronic
960587059 3:119329763-119329785 ATTCCACAGTGCCCAGTGAAAGG + Intronic
963080010 3:141382759-141382781 TTCCCACAGTTCCCAGGGCCTGG + Intronic
963085392 3:141430964-141430986 GTCCCAGAGTTCCCCAGGACAGG - Intronic
964335461 3:155649571-155649593 ATCACACAGCACCCTGGGACAGG + Intronic
969142859 4:5094958-5094980 AGCCCACAGTGCCCAGGGCAGGG - Intronic
969692249 4:8710175-8710197 ATTCCCCAGTGCCCGGGAACAGG + Intergenic
970460693 4:16272078-16272100 ATCCCAAAGTGCCCCTGGTGCGG + Intergenic
985280632 4:188282859-188282881 ATTCCACCGAGCCCCGGGAGCGG - Intergenic
985625424 5:982924-982946 GTCCCACAGTGCCCCGGCCTTGG - Intergenic
995015188 5:107301959-107301981 CTCCCACACTGCCCAGAGACCGG - Intergenic
997663112 5:135604454-135604476 ATCCCTCAGTGCCCCAGGACTGG - Intergenic
999402238 5:151274074-151274096 AAGCCACAGTGCCCTGGGAATGG - Intergenic
1005869802 6:29966301-29966323 ATCCCAGAGTGCCCTTGGCCGGG - Intergenic
1007380953 6:41489756-41489778 ATCCCACAGAGACCCAGGCCTGG - Intergenic
1007717792 6:43867373-43867395 ATCCCACCATGCCCTGGGGCAGG - Intergenic
1008639367 6:53445806-53445828 TTCCCACAGTCTCCCAGGACTGG - Intergenic
1008885741 6:56430396-56430418 CTCCCACAGGGCCTTGGGACTGG + Intergenic
1019385879 7:755980-756002 ATCCCACAGTGCAGAGGGGCTGG + Intronic
1019385942 7:756291-756313 ATCCCACAGTGCAGAGGGGCTGG + Intronic
1021538254 7:21728900-21728922 ATCCCAGTGGGCCCCGGTACAGG - Intronic
1025231235 7:57204477-57204499 ATCCCACACAGCCCAGGGCCAGG - Intergenic
1027540621 7:79459556-79459578 CACCCACAGTGTCCCTGGACTGG - Intergenic
1032344780 7:131107675-131107697 ATCCCAAAGTCCTGCGGGACCGG + Intergenic
1033328509 7:140398551-140398573 CTCCCAGCGTGCCCCGCGACGGG - Intronic
1034274889 7:149819708-149819730 TTCCCACAGTGCCCGGGGGCTGG + Intergenic
1034564775 7:151904390-151904412 TTCCCACAGGGCCCCGGGTCAGG - Intergenic
1034967461 7:155400128-155400150 TTCCCACGGTGCCCGGGGCCGGG + Intergenic
1036497329 8:9281116-9281138 ATCCCACAGGGCCCCCCTACTGG - Intergenic
1037914041 8:22761210-22761232 ACCCCACAGTTCCCCGGGGCAGG - Intronic
1040510413 8:48088343-48088365 ATCCCACAGGCCCACAGGACTGG - Intergenic
1041646473 8:60257719-60257741 AGCCTACAGTGACCCGTGACTGG + Intronic
1043313766 8:78894888-78894910 TTCTCACAATGCCCCAGGACAGG + Intergenic
1044550376 8:93505502-93505524 ATCCCCCAGTGCTCCGGGGAAGG + Intergenic
1048967784 8:139626668-139626690 AGCCCACAGTTCCCTGGGACAGG + Intronic
1049478267 8:142806898-142806920 ACCCCACAGTCCCCCAGGCCTGG - Intergenic
1049875006 8:145011725-145011747 CTCCCACAGGGCCTTGGGACTGG - Intergenic
1052699676 9:31922520-31922542 ATCCCACAGTGGCCCAGGTTAGG - Intergenic
1053004147 9:34593248-34593270 ATCCGACAGAGCCCCGGGCCGGG + Intergenic
1053149297 9:35732546-35732568 GTCCCACAGTGCCACGGGGTGGG + Exonic
1053222342 9:36322870-36322892 TTCCCACAGTGCACCAGGATTGG + Intergenic
1053369864 9:37551623-37551645 TTCCAAGAGTGCCCCGGGCCTGG + Intronic
1055626053 9:78178603-78178625 GTCCCACGGTGCCACGGGAAAGG + Intergenic
1187412486 X:19063261-19063283 ATCTCCCAGAGCCCCGGGTCGGG + Intronic
1190292457 X:49001705-49001727 ATACCACTGTGCCCGGGGATTGG - Intronic
1192503734 X:71668739-71668761 TTCCCAGAGTGCCCCGGGGTAGG - Intergenic
1194935088 X:99938997-99939019 CTCCCACAGGGCCTTGGGACTGG + Intergenic