ID: 1143401918

View in Genome Browser
Species Human (GRCh38)
Location 17:6651724-6651746
Sequence CTCAGGCGCTCCCACGGCCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 314}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143401918_1143401926 9 Left 1143401918 17:6651724-6651746 CCCGGGCCGTGGGAGCGCCTGAG 0: 1
1: 0
2: 2
3: 12
4: 314
Right 1143401926 17:6651756-6651778 TCCAGTGTTTTAGCCTTCGAAGG 0: 1
1: 0
2: 0
3: 4
4: 78
1143401918_1143401928 16 Left 1143401918 17:6651724-6651746 CCCGGGCCGTGGGAGCGCCTGAG 0: 1
1: 0
2: 2
3: 12
4: 314
Right 1143401928 17:6651763-6651785 TTTTAGCCTTCGAAGGACCATGG 0: 1
1: 0
2: 0
3: 2
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143401918 Original CRISPR CTCAGGCGCTCCCACGGCCC GGG (reversed) Exonic
900157769 1:1210401-1210423 CACAGACGCTCCCAAGGCCCTGG - Intergenic
900164498 1:1239375-1239397 CCCAGGCGCCCCCAGGGGCCAGG + Intergenic
900185649 1:1331974-1331996 CACAGGGGCTCCCACGGGCAGGG - Intronic
900206331 1:1433428-1433450 CACAGGGACTCCCACAGCCCAGG + Intergenic
900227610 1:1540385-1540407 CCCCGGCGCCCCCCCGGCCCCGG + Intronic
900313891 1:2047775-2047797 CTGGGGCACTGCCACGGCCCTGG + Intergenic
900342443 1:2195285-2195307 CTCAGCTGCCCCCAGGGCCCTGG - Intronic
900799574 1:4728910-4728932 CTCCGGGGCTCCATCGGCCCTGG + Intronic
900970387 1:5989405-5989427 CCCAGGTGCTCCCAGGGTCCAGG + Intronic
901557263 1:10041566-10041588 CTCAGGCGATCCCCCCGCCTCGG + Intronic
901654818 1:10763154-10763176 CTGAGGCTTTCCCACAGCCCAGG + Intronic
901784471 1:11615643-11615665 CTCAAGCGATCCCCCGGCCTCGG - Intergenic
902421955 1:16287848-16287870 CTCAGGCGATCCACCCGCCCCGG - Intronic
902950758 1:19881376-19881398 CTCAGGCGATCCCCTGGCCTCGG + Intergenic
903173060 1:21565431-21565453 ATCACGGCCTCCCACGGCCCTGG - Intronic
904039556 1:27575951-27575973 CTCGGGCTCTGCCCCGGCCCGGG + Intronic
904236628 1:29121338-29121360 CTCCGGCCCCCCGACGGCCCGGG - Exonic
906109383 1:43312854-43312876 CTCATGCCCTCCCATGACCCTGG - Intronic
906746730 1:48226909-48226931 CTCAGGCGGTCCCAGGGTGCTGG - Intronic
907650214 1:56287708-56287730 CTCAGGAGCTCCCAAAGCCTGGG + Intergenic
907671223 1:56476630-56476652 CTCAGGCGATCCACCTGCCCGGG - Intergenic
909807924 1:79894380-79894402 CTCAGCAGGTCCCACGGCCATGG - Intergenic
909930325 1:81490363-81490385 CTCAGGTGATCCACCGGCCCTGG + Intronic
914755885 1:150561407-150561429 CTCAGCCCCGCCCAGGGCCCTGG - Intergenic
915394562 1:155572881-155572903 CTCAGGCGATCCACCCGCCCTGG + Intergenic
916075304 1:161197134-161197156 CTCTGGGGCTCCCGCAGCCCTGG - Intronic
916390144 1:164322041-164322063 CTCAGGCGATCCACCCGCCCCGG + Intergenic
917823501 1:178791360-178791382 CTCAAGCGATCCCCCGGCCTCGG + Intronic
918053083 1:180991500-180991522 CTCAGGAGCACACAAGGCCCTGG - Intronic
920688939 1:208131104-208131126 CTCAGGGGCACCCAGAGCCCTGG + Intronic
924453527 1:244199757-244199779 CTCAGGCGATCCACCTGCCCTGG - Intergenic
924466238 1:244301514-244301536 CTCAGGCGATCCACCGGCCTCGG - Intergenic
1063298206 10:4826840-4826862 CTCAGGCGATCCTACTGCCTCGG - Intronic
1064691000 10:17918316-17918338 CTAAGGCCCTCCCAGGGCCTTGG + Intergenic
1066118032 10:32257379-32257401 CTCAGGCGATCCTCCTGCCCTGG - Intergenic
1067687936 10:48479043-48479065 CTCAGGCCCTCCCACTCGCCTGG + Intronic
1069837658 10:71319385-71319407 CGCAGCCGCCCCCAGGGCCCGGG - Intronic
1070393137 10:75988726-75988748 CCCAAGTGCTCCCAAGGCCCAGG + Intronic
1071360909 10:84845143-84845165 CTCAGGTGATCCCCCGGCCTCGG - Intergenic
1073137358 10:101227380-101227402 CCCAGGCGCCCCGAAGGCCCCGG - Exonic
1075713071 10:124541089-124541111 CTCCGGCCATCCCAGGGCCCAGG - Intronic
1076120794 10:127935202-127935224 CTCTGCCCCTCCCACTGCCCAGG + Intronic
1076920010 10:133446405-133446427 CACGGTCTCTCCCACGGCCCCGG + Intergenic
1077313947 11:1907645-1907667 CTCAGGTGATCCAACCGCCCCGG + Intergenic
1077394653 11:2315104-2315126 CCCAGTCTCTCCCAGGGCCCTGG - Intronic
1078229356 11:9425505-9425527 CTCAGGTGATCCCCCCGCCCTGG - Intronic
1079485279 11:20929736-20929758 CTCAGGTGATCCGACGGCCTCGG - Intronic
1079941856 11:26690575-26690597 CTCAGGTGATCCCCCGGCCTTGG - Intronic
1081634890 11:44714512-44714534 CCCAGGTGCTCCCTGGGCCCTGG + Intergenic
1083768906 11:64855506-64855528 ATCAGGCGCTCTCTTGGCCCAGG + Intronic
1083922251 11:65787236-65787258 CTAAGGCGCCCCCACGTTCCGGG - Exonic
1084268620 11:68017488-68017510 CTCAGGCGCTGCCTCAGCCAGGG + Intronic
1085229568 11:74953424-74953446 CTCAGGTGATCCAACGGCCTCGG + Intronic
1085608466 11:77924159-77924181 CTCAGGTGATCCCCCTGCCCCGG - Intronic
1087779381 11:102286872-102286894 CTCAGGCGATCCACCGGCCTTGG - Intergenic
1089275699 11:117334550-117334572 CTCAGGTGATCCACCGGCCCTGG - Intronic
1089298066 11:117481535-117481557 CTCAGCCCCTCCCACTCCCCTGG - Intronic
1090171506 11:124610205-124610227 CTCAGACTCTCCCAAGCCCCTGG + Intergenic
1090277794 11:125431910-125431932 CTCAGGCCCTCCCACTCCTCTGG - Exonic
1091395342 12:151004-151026 CTCAGGAGCACCCAGGGGCCTGG - Intronic
1091849454 12:3683471-3683493 CTCAAGAGCTCCCAGGGCCATGG - Intronic
1092373350 12:7935218-7935240 CTCAGGCGATCCGCCGGCCTCGG - Intronic
1092661927 12:10748017-10748039 CTCAGTGGGTCCCACGGCCACGG - Intergenic
1093019673 12:14191904-14191926 ATCAGGTTCTCCCACTGCCCTGG + Intergenic
1093085943 12:14867128-14867150 CTCAGAGGCTCCCACGCCCATGG - Intronic
1096397929 12:51280602-51280624 CTCAGGCGATCCACCGGCCTCGG + Intergenic
1096502000 12:52069925-52069947 CTCACCAGATCCCACGGCCCCGG - Intronic
1097194409 12:57235768-57235790 CTCAGGCGGTTCCAGGGCTCCGG + Exonic
1098535674 12:71591526-71591548 CTCAAGCGCTCCCCTGGCCTTGG + Intergenic
1098929703 12:76397046-76397068 CTCAAGCGATCCAACTGCCCTGG + Intronic
1100491233 12:95080183-95080205 CTCAGGTGGTCCAACGGCCTCGG + Exonic
1101331013 12:103758002-103758024 CTCAAACTCTCCCACGGCGCAGG + Intronic
1102184799 12:110939659-110939681 CTCAAGCGATCCCCCAGCCCTGG + Intergenic
1102437223 12:112934210-112934232 CTCAGGTGATCCAACGGCCTTGG - Intergenic
1103723584 12:122987211-122987233 CTCAGGGGCTCCCACCAGCCAGG - Intronic
1104021240 12:124993805-124993827 CTCAGGCGGGCCCCTGGCCCGGG + Exonic
1104918334 12:132277973-132277995 CTGAGGCCCTCCCCCCGCCCCGG + Intronic
1105385204 13:19923104-19923126 CTCAGGCGATCCCCCCGCCTCGG - Intergenic
1105471560 13:20699948-20699970 CTCAGGCGATCCACCGGCCTTGG - Intergenic
1107812409 13:44213128-44213150 CTCAGATGCTCCCAGGGGCCCGG - Intergenic
1109789715 13:67230614-67230636 CGCTGGCGCTCCCCAGGCCCGGG + Intergenic
1110660299 13:78053070-78053092 CTTAGGCACTGCCATGGCCCTGG + Intergenic
1112208199 13:97346738-97346760 CCCAGGCGCCCCTGCGGCCCCGG - Intronic
1112580640 13:100674397-100674419 CGCCGGCGCTCCCTCGGCCCGGG - Intronic
1113598702 13:111553055-111553077 CACAGGCACTCCCACAGCCCAGG - Intergenic
1113782745 13:112986027-112986049 CTCAGCCCCACGCACGGCCCTGG - Intronic
1113807164 13:113116620-113116642 AGCAGGAGCTCCCAGGGCCCAGG - Intronic
1113911560 13:113843716-113843738 CTCAGGCTGTCCCAGGACCCAGG - Intronic
1117199117 14:53370599-53370621 CTCATGGTATCCCACGGCCCTGG - Intergenic
1121074945 14:91060280-91060302 CTCAGGCGCGCCCCCGCGCCGGG + Intronic
1121117763 14:91355496-91355518 CTCAGCTGCACCCACGCCCCCGG - Intronic
1121644811 14:95510553-95510575 CTCAGGCGATCCACCGGCCTCGG - Intergenic
1122044598 14:99014404-99014426 CTCAGATGCTCCCAGGGCCTAGG + Intergenic
1122048153 14:99038006-99038028 CTGAGCCTCTCCCAGGGCCCGGG + Intergenic
1122116602 14:99530690-99530712 CCCAGGCGGTCCCAAGGGCCTGG - Intronic
1122403157 14:101479357-101479379 CTCAGGCACTCAGAAGGCCCAGG - Intergenic
1122640444 14:103156264-103156286 CTCAGTCGCTCCCACTGCATGGG + Intergenic
1124023674 15:25945553-25945575 CTCAGGCCCTCCCACCACCTTGG - Intergenic
1124252926 15:28118892-28118914 CTCTGGCTCAGCCACGGCCCCGG - Intronic
1125862000 15:43008361-43008383 CCCAGGCGCTGCCGCGGCCCCGG + Intronic
1126104886 15:45141093-45141115 CTCAGGCTCTACCTCGGCCTGGG + Intronic
1126538443 15:49794886-49794908 CTCTGGCTCTCCCACGGTCTGGG - Intergenic
1127116474 15:55732725-55732747 CTCAGGTGATCCGCCGGCCCTGG + Intronic
1131808680 15:96149924-96149946 CTCAGGCGATCCCCCCGCCTTGG + Intergenic
1132404162 15:101532337-101532359 CTCAGGTGATCCCCCGGCCTTGG + Intergenic
1133070715 16:3245051-3245073 CTCAAGCGATCCCACTGCCCCGG - Intronic
1134151789 16:11811062-11811084 CTCAGGTGATCCACCGGCCCCGG + Intergenic
1136773667 16:32860267-32860289 CTCTGGCCCTGCCCCGGCCCTGG + Intergenic
1136841607 16:33546142-33546164 CTCTGGCCCTGCCCCGGCCCTGG - Intergenic
1136896945 16:34001252-34001274 CTCTGGCCCTGCCCCGGCCCTGG - Intergenic
1137655250 16:50153536-50153558 CTCAGGCGCACGCCCGGCCTCGG - Intronic
1138556027 16:57771697-57771719 CACATGCGCCCCCTCGGCCCTGG - Intronic
1139320336 16:66109324-66109346 ATCAGGCACACCCAGGGCCCAGG + Intergenic
1140075547 16:71695473-71695495 CTCAGGTGATCCGACGGCCTTGG - Intronic
1140979335 16:80091639-80091661 TACAGGCGCCCCCACTGCCCAGG - Intergenic
1141884456 16:86882290-86882312 CTCAGGCTGTCCCAAGACCCAGG + Intergenic
1142336118 16:89490421-89490443 CTCGGGCGCGCCCACGGCTCGGG + Exonic
1203076086 16_KI270728v1_random:1122378-1122400 CTCTGGCCCTGCCCCGGCCCTGG + Intergenic
1203151772 16_KI270728v1_random:1846439-1846461 CTCTGGCCCTGCCCCGGCCCTGG - Intergenic
1142594129 17:1021323-1021345 CTCGGTCACTCCCACCGCCCAGG + Intronic
1142599366 17:1046102-1046124 CTCAGGTGATCCCCCCGCCCTGG + Intronic
1142718533 17:1761632-1761654 CTCAGGTGATCCCCCGGCCTCGG + Intergenic
1142973319 17:3627938-3627960 CCAAGCAGCTCCCACGGCCCCGG + Intronic
1143401918 17:6651724-6651746 CTCAGGCGCTCCCACGGCCCGGG - Exonic
1143585632 17:7848907-7848929 CTCAGGCGGGCCCTGGGCCCGGG + Exonic
1144384691 17:14738383-14738405 ATCAGGCTCTCCCAGGGTCCAGG - Intergenic
1148286607 17:46398772-46398794 CTCAGGCGATCCCCCTGCCTCGG + Intergenic
1148308773 17:46616362-46616384 CTCAGGCGATCCCCCTGCCTCGG + Intronic
1148744381 17:49910294-49910316 CGGTGGCGCTCCCACGACCCGGG + Intergenic
1149824843 17:59818535-59818557 CTCAGGCGATCCGCCTGCCCTGG - Intronic
1150388079 17:64776036-64776058 CTCAGGCACAGCCACGGTCCTGG - Intergenic
1150772161 17:68051378-68051400 CTCAGGCGATCCGCCGGCCTAGG + Intergenic
1151597640 17:75088027-75088049 CTCACCCGCTCGCACGGGCCTGG - Intronic
1151834576 17:76574409-76574431 CTCAGGCGGTCCCAGAGCGCTGG + Exonic
1152000302 17:77641079-77641101 CCCCAGCGCTCCCCCGGCCCTGG - Intergenic
1152387056 17:79980933-79980955 CTCAGGGCCTCCCGGGGCCCAGG - Intronic
1153312213 18:3688142-3688164 CTCAGGGGATCCAACGGCCTCGG + Intronic
1154358711 18:13641977-13641999 CGGAGGCCCTCCCACCGCCCAGG - Intronic
1155149140 18:23108975-23108997 CTCAGGCGATCCAACTGCCTCGG + Intergenic
1157594149 18:48853677-48853699 ATCAAGCACTCCTACGGCCCTGG + Intronic
1157839375 18:50941606-50941628 CTCAGGTGATCCACCGGCCCTGG + Intronic
1158652110 18:59297511-59297533 CTCAGGCGATCCAACCACCCCGG + Intronic
1160707220 19:535307-535329 CTCATCCCCTCCCACGGCCTGGG + Intronic
1160847292 19:1172244-1172266 CTCAGGGCCTCCCACGGCAGGGG - Intronic
1160870663 19:1276308-1276330 CTTGGGTGCTCCCACAGCCCGGG + Intronic
1161015279 19:1980067-1980089 CTCAGGCCCTCCCACCCCCATGG - Intronic
1161033338 19:2070153-2070175 CTCAGGCGATCCCCCTGCCTCGG - Intergenic
1161233451 19:3186805-3186827 CCCACCCCCTCCCACGGCCCTGG + Intronic
1162397282 19:10424427-10424449 CCCTGGCGCTCCCAAGTCCCTGG + Intronic
1162906005 19:13824496-13824518 CTCAGGTGATCCCCCGGCCTCGG - Intronic
1163392197 19:17037484-17037506 ATCAGACACTCCCAGGGCCCGGG + Intergenic
1164692736 19:30222906-30222928 CTCCGTGCCTCCCACGGCCCAGG + Intergenic
1164959124 19:32412107-32412129 CTCAAGCGATCCTACTGCCCTGG + Intronic
1164977031 19:32581166-32581188 CGCAGGCGCTCGCGGGGCCCAGG - Exonic
1165220450 19:34311842-34311864 CTCAGGTGATCCCCCTGCCCTGG + Intronic
1165527455 19:36368233-36368255 CTCAGGTGCTCCAACTGCCTTGG - Intronic
1165772908 19:38388898-38388920 CCCAGGCGCCCCCAAGGCCCCGG + Intronic
1166120216 19:40681904-40681926 CTCAGGTGATCCAACTGCCCTGG + Intronic
1166364913 19:42273420-42273442 CTCACGGGCTGCCACGGCCGCGG - Intronic
1166730716 19:45057629-45057651 CTCAGGCTCTCCCTCAGCCTAGG - Intronic
1166753629 19:45177560-45177582 CTCAGGTGATCCGACGGCCTCGG + Intronic
1167164120 19:47786628-47786650 CTCAGGCGATCCCCCCGCCTCGG + Intergenic
1167166672 19:47803656-47803678 CCCAGGCCCTCCCCTGGCCCTGG - Exonic
1167175165 19:47860108-47860130 CCCAGGCCCTCCCCTGGCCCTGG + Intergenic
1167530149 19:50010677-50010699 CTCAGGCGATCCACCCGCCCTGG - Intronic
1168123883 19:54272143-54272165 CTGAGGCCCTCCCATGACCCAGG - Intronic
1168178476 19:54643392-54643414 CTGAGGCCCTCCCATGACCCAGG + Intronic
926144136 2:10386528-10386550 CTCACCCCCTCCCAGGGCCCTGG - Intronic
927862921 2:26571270-26571292 CCCAGGGGCTCCCCCTGCCCTGG + Intronic
928940851 2:36725836-36725858 CTCAGGCGATCCTCCTGCCCCGG - Intronic
932147024 2:69329982-69330004 CTCAAGCGATCCCCCTGCCCTGG - Intronic
932421591 2:71604497-71604519 CTCATGGGCTCCCATGGCCAGGG - Intronic
934323346 2:91985545-91985567 CTCTGGCCCTCCCTTGGCCCTGG - Intergenic
934572733 2:95382884-95382906 CTCAGTTGCTCCCTCTGCCCTGG + Intronic
934770476 2:96904625-96904647 CTCAGGTGATCCAACTGCCCTGG + Intronic
939388805 2:141538870-141538892 CTCAGGTGATCCCCCGGCACTGG + Intronic
942058492 2:172206826-172206848 CTCAGGTGCTCCACCGGCCTCGG + Intergenic
942780547 2:179636585-179636607 CTCAGGCCCTCTCAGGGCCTTGG + Intronic
943543803 2:189249929-189249951 CTCAGGTGATCCCCCGGCCTCGG + Intergenic
944859302 2:203799446-203799468 CTCAGGTGATCCCCCGGCCTTGG - Intergenic
947043841 2:225954521-225954543 CTCAGGCGATCCACCGGCCTTGG - Intergenic
947630338 2:231648671-231648693 GTCAGGCGCACCCACTGCCTTGG + Intergenic
948705746 2:239791330-239791352 CTCATGCACTCCCACGGTCCTGG + Intronic
948790013 2:240372249-240372271 CCCAGGCCCTCCCCCAGCCCAGG - Intergenic
948825999 2:240573696-240573718 ACCAGGCTCTCCCACTGCCCTGG - Intronic
1170629597 20:18056286-18056308 CTCAGGAACTCCGACGGCCTTGG + Intronic
1171524254 20:25797050-25797072 CACAGGCGCCCCCACCCCCCGGG - Intronic
1171552573 20:26058833-26058855 CACAGGCGCCCCCACCCCCCGGG + Intergenic
1172334174 20:34100246-34100268 CTCAGGTGATCCACCGGCCCGGG + Intronic
1172605043 20:36208361-36208383 CTCAGGCGCCCCCCCTTCCCAGG - Intronic
1173181976 20:40812706-40812728 CTCAGCGCCTCCCAAGGCCCTGG + Intergenic
1174040259 20:47694366-47694388 CTCAGCCTTTCCCCCGGCCCAGG - Intronic
1176248881 20:64110574-64110596 CTCAGGCTGTCCCAGGGTCCTGG - Intergenic
1180195324 21:46190462-46190484 CTCAGGCGAGCTCACGACCCAGG + Exonic
1180918984 22:19508771-19508793 CACAGTCACTCCCACAGCCCTGG - Intronic
1180985824 22:19903488-19903510 CTCTTGCACACCCACGGCCCTGG - Intronic
1181483792 22:23218183-23218205 CTCAGGCCCTGCCAGTGCCCTGG + Intronic
1183217592 22:36490920-36490942 CTCAGGCGATCCACCGGCCTCGG - Intronic
1183629667 22:39025511-39025533 CTCAGGCTCTCCCCTGACCCTGG - Intronic
1183967836 22:41453623-41453645 CTCAGGTGATCCCCCGGCCTTGG - Intergenic
1184817433 22:46882570-46882592 CGCAGGCCCTCCAACGCCCCAGG - Intronic
1185061283 22:48608100-48608122 GCCAGCCCCTCCCACGGCCCCGG + Intronic
950308664 3:11936706-11936728 CTCAAGCGATCCCACTGCCTCGG + Intergenic
950453507 3:13079046-13079068 CTGAGGCCCTCACAAGGCCCTGG + Intergenic
953407407 3:42666293-42666315 CTCAGGCGCTCCTGCTGTCCTGG + Intergenic
953434855 3:42870457-42870479 CTCAGCAGCTCTCACAGCCCAGG + Intronic
954163594 3:48739180-48739202 CTCAGCTGCACCCACAGCCCTGG + Intronic
954539481 3:51384423-51384445 CTCAGGAGGTCCCACGGCAGCGG + Intergenic
956678107 3:71753950-71753972 CTCCGCCGCTCCGCCGGCCCTGG - Intronic
958435310 3:94088900-94088922 CTCAGGCGATCCACCGGCCTCGG + Intronic
961252867 3:125521420-125521442 CTCAGGCGATCCGCCGGCCTTGG - Intergenic
961876238 3:130025790-130025812 CTCCCCCGCTCCCCCGGCCCCGG - Intergenic
962054946 3:131861664-131861686 CTCAGGCGATCCACCGGCCTCGG + Intronic
962861308 3:139404893-139404915 CTCAGTGGCTCCCACGCCCACGG + Intergenic
965554854 3:170008263-170008285 CTCAGGTGATCCGACCGCCCTGG + Intergenic
966844157 3:184113841-184113863 CTCAGGTGATCCACCGGCCCTGG - Intergenic
966923620 3:184630284-184630306 CTCAGGCCCTCCATCTGCCCCGG - Intronic
968286028 3:197509395-197509417 CTCAGGCGATCCGACCGCCTGGG + Intergenic
968573103 4:1352716-1352738 CTCAGGCGATCCGCCTGCCCTGG - Intronic
968632868 4:1661224-1661246 CTCACAGGCTCCCACGGCCATGG + Intronic
968761396 4:2444227-2444249 CTCAGGGGCCCCCATGGCCTGGG + Intronic
969566509 4:7981947-7981969 CTCAGGGGCTTCCCCGGGCCTGG + Intronic
970257960 4:14189062-14189084 CTCAGGCGATCCAACTGCCTCGG - Intergenic
972641386 4:40928307-40928329 CTCAGGCGATCCCACTGCCTCGG - Intronic
975542171 4:75524989-75525011 CTCAGGCGATCCCCCTGCCTCGG + Intronic
975616524 4:76252271-76252293 CCCAGGCGCTCCCCCAACCCTGG - Intronic
977322522 4:95536307-95536329 CTCAGGCGATCCACCGGCCTTGG + Intronic
978261502 4:106766019-106766041 CTCAGGCGATCCACCGGCCTCGG - Intergenic
982334796 4:154222344-154222366 CTCAGGTGCTCCAACTGCCTCGG - Intergenic
984411265 4:179401347-179401369 GTCAGGTGATCCCCCGGCCCCGG + Intergenic
985068447 4:186144979-186145001 GTCACGCGCCCCCGCGGCCCCGG - Exonic
997353605 5:133248226-133248248 CTCAGGGGGTCACACAGCCCAGG + Intronic
997372258 5:133369604-133369626 CACAGCCCCTCCCACTGCCCAGG + Intronic
998252885 5:140564405-140564427 CTCAGGCCCTCCCCCGGGACCGG - Intronic
998463592 5:142326053-142326075 CTCGGCCGCTCCCACTTCCCCGG - Intronic
999300270 5:150486319-150486341 CGGAGGCGCACGCACGGCCCGGG + Intronic
1004560025 6:16740764-16740786 CTCAGGCGATCCCACCGCCTTGG + Intronic
1005291406 6:24383091-24383113 CTCAGGTGATCCCACTGCCTCGG - Intergenic
1006097268 6:31663971-31663993 CCCAGGCAGCCCCACGGCCCAGG + Exonic
1006139713 6:31920929-31920951 CCCAGGCTCTTCCAGGGCCCTGG - Intronic
1006815575 6:36847674-36847696 CTCAGCCTCTGCCATGGCCCAGG + Intergenic
1007357547 6:41332486-41332508 TTCAGCCGCCCCCAGGGCCCCGG - Intergenic
1010350196 6:74864427-74864449 CTCAGGCTACCCCACTGCCCAGG + Intergenic
1012945717 6:105463612-105463634 CTCAGGTGATCCACCGGCCCTGG - Intergenic
1013523947 6:110957710-110957732 CTCAGGCGATCCCCCTGCCTGGG - Intergenic
1014668410 6:124269699-124269721 CTCAGGTGATCCAACGGCCTCGG + Intronic
1018639201 6:165891323-165891345 CTCAGGTGCCACCAGGGCCCAGG + Intronic
1018799513 6:167211099-167211121 CCCAGGCCCTCCCAGGGCCAGGG - Intergenic
1019406306 7:885917-885939 AGCAGCCGCTCCCAGGGCCCAGG - Intronic
1019417738 7:935083-935105 CTCCGGAGCTCCCAGGGCACGGG + Intronic
1019756174 7:2771890-2771912 CTCAGGCTCTCACACACCCCTGG - Intronic
1019996308 7:4726640-4726662 CTCAGGCACCTCCAAGGCCCAGG - Intronic
1020080674 7:5284148-5284170 CTCAGGTGATCCCTCAGCCCCGG - Intronic
1021772060 7:24014108-24014130 CTCAGGTGATCCACCGGCCCCGG - Intergenic
1021788059 7:24172453-24172475 CTCAGGCCCTCCTAAGGCCGTGG + Intergenic
1023865005 7:44234342-44234364 CTCAGCCCCTCCTACGCCCCTGG - Intronic
1023914249 7:44576788-44576810 CTCAGGCGATCCCCCTGCCTTGG + Intergenic
1024512370 7:50213820-50213842 CTCAGCCCCTCCCACTGCCCTGG - Intergenic
1024686869 7:51755655-51755677 CTCAGGCGATCCACCCGCCCCGG + Intergenic
1025673697 7:63628907-63628929 CTCAGGTGATCCCTCAGCCCCGG - Intergenic
1025818286 7:64940164-64940186 CTCAGGCGATCCACCTGCCCTGG + Intergenic
1025861089 7:65328691-65328713 CTCAGGCGATCCAACTGCCTCGG + Intergenic
1026101138 7:67385499-67385521 CTCAGCCCCTCCCACAGCACTGG + Intergenic
1029387922 7:100256025-100256047 CTCAGGCGATCCGACTGCCTCGG + Intronic
1029629931 7:101743861-101743883 CTCACACCCTCCCCCGGCCCAGG + Intergenic
1029688223 7:102163483-102163505 CTCAGACCCTCCCACAGGCCTGG - Intronic
1033135780 7:138782839-138782861 CTCAGGCGATCCAACTGCCTCGG - Intronic
1034493806 7:151408682-151408704 CTCTGGCCCTCCTACTGCCCAGG - Intronic
1034969934 7:155412669-155412691 CCCAGGCCCTGCCCCGGCCCTGG + Intergenic
1035171975 7:157021897-157021919 CTGAGGGGCTCCCAAGACCCCGG - Intergenic
1035203134 7:157279349-157279371 CACAACCGCTCCCGCGGCCCTGG - Intergenic
1036513573 8:9422624-9422646 CTCAAGCGGTCCCCCGGCCTCGG - Intergenic
1038033601 8:23666330-23666352 CTCAGGCGATCCGACTGCCTGGG + Intergenic
1038073612 8:24045994-24046016 CTCAGGGGATCCCCCGGCCAGGG + Intergenic
1040572655 8:48624276-48624298 CCCAGGGCTTCCCACGGCCCAGG - Intergenic
1040913862 8:52548113-52548135 CTCAGGCGATCCACCGGCCTCGG - Intronic
1041061628 8:54040382-54040404 CTCAGGTGATCCCCCGGCCTTGG + Intergenic
1042292495 8:67184084-67184106 CTCAGGTGATCCCCCGGCCTTGG + Intronic
1042878046 8:73457831-73457853 CTCAGGCTCTGCCCCAGCCCAGG - Intronic
1042957950 8:74271868-74271890 TGCAGGGGCTCCCACTGCCCTGG + Intronic
1044987250 8:97766454-97766476 CTCAGGTGATCCCCCTGCCCCGG + Intergenic
1048764810 8:137832315-137832337 CTAAGGCCCTTCCAAGGCCCTGG - Intergenic
1049117751 8:140704416-140704438 CTCAGGGGCTTCCACTGCACTGG + Intronic
1049268777 8:141683339-141683361 CCCAGCCGCTCCCAGGTCCCCGG + Intergenic
1049269222 8:141685308-141685330 CTCAGGCGCTTTCGCAGCCCAGG - Intergenic
1049273500 8:141708273-141708295 CCCTGGAGCTCCCAGGGCCCTGG - Intergenic
1049283092 8:141760505-141760527 CACAGACGCTCCCAGGGACCAGG + Intergenic
1049310886 8:141933280-141933302 CTCAGGTGCTCCCAGGGCCCAGG - Intergenic
1049554728 8:143276131-143276153 CTCGGGCGCACCCTCGGGCCCGG - Exonic
1049625363 8:143617435-143617457 CTCAGCCGCGCCCTGGGCCCTGG - Intronic
1050214982 9:3312730-3312752 CTCAGGGGGTCCCACGCCCATGG + Intronic
1052485082 9:29087108-29087130 CTCAGGTGATCCACCGGCCCTGG + Intergenic
1053691634 9:40589906-40589928 CTCTGGCCCTGCCCCGGCCCTGG + Intergenic
1054273168 9:63047579-63047601 CTCTGGCCCTGCCCCGGCCCTGG - Intergenic
1054302890 9:63390872-63390894 CTCTGGCCCTGCCCCGGCCCTGG + Intergenic
1054401671 9:64717388-64717410 CTCTGGCCCTGCCCCGGCCCTGG + Intergenic
1054435274 9:65201697-65201719 CTCTGGCCCTGCCCCGGCCCTGG + Intergenic
1054495116 9:65819984-65820006 CTCTGGCCCTGCCCCGGCCCTGG - Intergenic
1057260142 9:93578278-93578300 CTAAGGGGCTTCCACAGCCCTGG - Intronic
1058774677 9:108271980-108272002 CTCAGGTGCACTCAGGGCCCTGG + Intergenic
1058976278 9:110127940-110127962 CTGAGGACCTCGCACGGCCCAGG + Intronic
1059817816 9:117937700-117937722 CTCAGGCGATCCAACTGCCTTGG + Intergenic
1060792971 9:126498215-126498237 CTCAGGCACTCCCACGGCCTCGG - Intronic
1060827140 9:126693818-126693840 CCCAGGCCCTGCCCCGGCCCCGG - Exonic
1060860319 9:126948663-126948685 CTCAAGCGCCCCCATGTCCCAGG - Intronic
1061148899 9:128817873-128817895 CTCAGGCGATCCGCCGGCCTCGG - Intergenic
1061149432 9:128820527-128820549 CTCTGTCCCTCCCACAGCCCAGG - Exonic
1061178666 9:129011767-129011789 CTCAGGCCCTCCCGCCCCCCAGG + Intronic
1061397202 9:130349619-130349641 CTCAGGGGTCCCCACGCCCCAGG + Intronic
1061976446 9:134070273-134070295 CCCAGGCGCTCCCTGGGCACTGG + Intergenic
1062174983 9:135156629-135156651 CTCAGGTGCTGGCAGGGCCCTGG + Intergenic
1062212442 9:135372283-135372305 TTCTGGAGCTCCCACTGCCCAGG - Intergenic
1062457048 9:136644803-136644825 CTCACGGGCTCCCAGGGCCCTGG - Intergenic
1062472381 9:136712287-136712309 GACAGGCGCGCCCCCGGCCCCGG + Intergenic
1062493737 9:136821896-136821918 CCCAGGCGCCCTCACGGCCACGG - Intronic
1185500352 X:592029-592051 CTCAGGCGATCCCCCTGCCTGGG - Intergenic
1185641613 X:1591917-1591939 TTCAGGCGCTCCCAGCCCCCCGG - Intronic
1186123155 X:6384500-6384522 CTAAGGCTTTCCCACAGCCCAGG + Intergenic
1186585637 X:10870165-10870187 CTCAGTGGCTCCCACGCCCATGG + Intergenic
1187336786 X:18388480-18388502 CTCAGGCGCTCCTCCTGCCTTGG - Intergenic
1188044839 X:25413833-25413855 CTCAGGAGGTCCCACGCCCACGG - Intergenic
1192510258 X:71717098-71717120 CTCAGCCGCTCCCCCGGAGCCGG - Exonic
1192516439 X:71764455-71764477 CTCAGCCGCTCCCCCGGAGCCGG + Exonic
1194065302 X:89253504-89253526 CACAGGGGATCCCACTGCCCTGG + Intergenic
1195900902 X:109796320-109796342 CTCAGGTGCTCCACCGGCCTTGG - Intergenic
1198398909 X:136251202-136251224 CTGCGCCGCTCCGACGGCCCGGG + Intronic
1199874996 X:151922014-151922036 CCCAGGACCTCCCAGGGCCCAGG - Intronic
1200277764 X:154750835-154750857 CGCAGCCGCTCCCAGCGCCCGGG - Intronic
1200719472 Y:6587588-6587610 CACAGGGGATCCCACTGCCCTGG + Intergenic