ID: 1143401978

View in Genome Browser
Species Human (GRCh38)
Location 17:6651964-6651986
Sequence CCGTGGACGTCTCTGTGTAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 70}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143401978_1143401987 21 Left 1143401978 17:6651964-6651986 CCGCTACACAGAGACGTCCACGG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1143401987 17:6652008-6652030 ACCGCGTGGAGACGTCGTCCCGG 0: 1
1: 0
2: 0
3: 0
4: 23
1143401978_1143401991 28 Left 1143401978 17:6651964-6651986 CCGCTACACAGAGACGTCCACGG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1143401991 17:6652015-6652037 GGAGACGTCGTCCCGGCGGGTGG 0: 1
1: 0
2: 0
3: 8
4: 65
1143401978_1143401990 25 Left 1143401978 17:6651964-6651986 CCGCTACACAGAGACGTCCACGG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1143401990 17:6652012-6652034 CGTGGAGACGTCGTCCCGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 39
1143401978_1143401983 7 Left 1143401978 17:6651964-6651986 CCGCTACACAGAGACGTCCACGG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1143401983 17:6651994-6652016 GGAGACCTCGTCCCACCGCGTGG 0: 1
1: 0
2: 0
3: 5
4: 47
1143401978_1143401989 24 Left 1143401978 17:6651964-6651986 CCGCTACACAGAGACGTCCACGG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1143401989 17:6652011-6652033 GCGTGGAGACGTCGTCCCGGCGG 0: 1
1: 0
2: 0
3: 0
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143401978 Original CRISPR CCGTGGACGTCTCTGTGTAG CGG (reversed) Exonic
900526977 1:3134204-3134226 CTGTGGGAGCCTCTGTGTAGAGG - Intronic
902706029 1:18205211-18205233 CCATGGCTTTCTCTGTGTAGTGG + Intronic
903704118 1:25272524-25272546 CTGTGTCCGTCTCTGTGCAGGGG - Intronic
903723118 1:25420788-25420810 CTGTGTCCGTCTCTGTGCAGGGG + Exonic
904133963 1:28296759-28296781 CCTTGGACTCCTCTGTGTGGGGG + Intergenic
918243612 1:182640855-182640877 CCTTGGAGGACTCTGTGGAGGGG - Intergenic
919408792 1:197217983-197218005 CAGAGGTTGTCTCTGTGTAGTGG + Intergenic
1076070623 10:127485388-127485410 CCGTGCACGTCACTGAGTAGTGG + Intergenic
1076919265 10:133442826-133442848 CCGTGGGCACCTCTGTGTAAAGG - Intergenic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077213922 11:1387336-1387358 TCCTGGAAGTGTCTGTGTAGCGG + Intergenic
1079967277 11:26994595-26994617 CATTGGACATCTCTGGGTAGAGG - Exonic
1084395963 11:68910497-68910519 CGATAGGCGTCTCTGTGTAGTGG + Intronic
1097233602 12:57526116-57526138 CCGAGGACGGCTCCGTCTAGGGG - Exonic
1101157394 12:101940635-101940657 ACGTGGGAGGCTCTGTGTAGGGG - Intronic
1103250514 12:119496041-119496063 CAGTGGACATCTCTGTGGAGTGG + Intronic
1108634807 13:52322822-52322844 CGGTGGCCATCTCTGTGGAGTGG + Intergenic
1108652997 13:52500366-52500388 CGGTGGCCATCTCTGTGGAGTGG - Intergenic
1113450794 13:110407985-110408007 TCCTGGACGCCTCTGTCTAGAGG - Intronic
1116467617 14:45252192-45252214 CAGTGAACTTCCCTGTGTAGTGG - Intronic
1119703086 14:76768359-76768381 CCGCTGACGTCTCTGTCTGGAGG - Intronic
1123108547 14:105854610-105854632 CCGCGGACGTCTTCGTGCAGTGG - Intergenic
1125894639 15:43292410-43292432 CGGTGGGTGTCTCTGAGTAGTGG - Intronic
1132727861 16:1346531-1346553 CCGTGGAGGACTGTGTGTACTGG + Intronic
1134431529 16:14212737-14212759 CCTTGGCTGTCTCTCTGTAGGGG - Intronic
1137955620 16:52825884-52825906 CTGGGTACGTCTCTGTGAAGAGG - Intergenic
1143401978 17:6651964-6651986 CCGTGGACGTCTCTGTGTAGCGG - Exonic
1146461879 17:33052609-33052631 CCCTGGAGGTCACTGGGTAGAGG - Intronic
1151731790 17:75915668-75915690 CAGTGGACATCTCTGACTAGTGG + Intronic
1157434893 18:47659990-47660012 ACATAGACCTCTCTGTGTAGTGG + Intergenic
1162836011 19:13318467-13318489 CCGTGGAGGGTTCTGAGTAGAGG + Intronic
1165310041 19:35024186-35024208 CCGTGGACTCCTCTGTGCACAGG + Intronic
1167494259 19:49808717-49808739 CCGAGGATGTCTGTGTGAAGGGG + Exonic
925005925 2:443073-443095 CCGAGGAGGTGGCTGTGTAGGGG - Intergenic
925580661 2:5406864-5406886 CTGTGGAAGTCTCTCTGGAGTGG + Intergenic
927516287 2:23673645-23673667 CTGTGTATGTGTCTGTGTAGGGG - Intronic
930207390 2:48601773-48601795 CCCTGGAAGGCTTTGTGTAGAGG + Intronic
937111031 2:119367287-119367309 GGGTGGACTTCGCTGTGTAGCGG + Intronic
938379271 2:130827444-130827466 CCGATGACTTCTCTGGGTAGGGG + Intergenic
942417580 2:175775178-175775200 ACATGGACGTCCCTTTGTAGAGG - Intergenic
947209888 2:227698920-227698942 CTGTGGACGTTTTTGTGCAGTGG - Exonic
948670388 2:239564633-239564655 ACGTGGACGTCTCTGGGGAGAGG + Intergenic
1169256082 20:4100176-4100198 CCCTGAACGTCTCTGTGTCTTGG + Intergenic
1173744502 20:45426177-45426199 CAGTGTATGTCACTGTGTAGTGG + Exonic
1176413053 21:6459131-6459153 CCTTGGGGGTCTCTGTGAAGGGG + Intergenic
1177640327 21:23836416-23836438 CCGTGGACAGCTCTGAGTGGTGG + Intergenic
1179688548 21:43067453-43067475 CCTTGGGGGTCTCTGTGAAGGGG + Intronic
1184437935 22:44490874-44490896 GCGTGGGGGGCTCTGTGTAGGGG - Intergenic
951955006 3:28243807-28243829 CCACGCACGTGTCTGTGTAGGGG - Intronic
966389157 3:179433355-179433377 CAGTGGATGTGTCTGTGTGGTGG - Intronic
968183239 3:196612661-196612683 CCGGGGAGGTCTCTTGGTAGAGG + Intergenic
968462992 4:735071-735093 CCCTGGGCGTCTCTGTGTGTGGG + Intronic
970116345 4:12700713-12700735 GAGTGGACTTCTCTGTCTAGAGG + Intergenic
981020860 4:140026658-140026680 CAGTGGCTGTCTTTGTGTAGGGG - Intronic
986468539 5:8050967-8050989 CTGTGGACATCTGTGTGCAGAGG + Intergenic
988738715 5:34048529-34048551 CCCTGCAGGTTTCTGTGTAGGGG + Intronic
989515663 5:42339773-42339795 CCCAGTAGGTCTCTGTGTAGGGG + Intergenic
992979246 5:82150670-82150692 CTGTGGACGACTGTGTGAAGGGG - Intronic
994418815 5:99507388-99507410 CCGTGGTAGTCTGTGTGTACTGG - Intergenic
999280709 5:150363563-150363585 CCCTGGGCCTTTCTGTGTAGGGG + Intronic
1001533160 5:172479147-172479169 CAGTGGACGTCCCTGAGAAGCGG + Intergenic
1007484679 6:42172834-42172856 GTGTGCACGTCTCTGTGTACTGG + Intronic
1013184583 6:107746636-107746658 CCATGGATGTCTCTCTGCAGAGG - Intronic
1014091332 6:117407094-117407116 CCCTAGACGTTTCTGTGGAGAGG - Intronic
1017876042 6:158524959-158524981 CCGTGGAAGGCTCTGGGCAGAGG - Intergenic
1017951408 6:159138068-159138090 GCGTGGATGTCTCTGTAAAGGGG + Intergenic
1029609591 7:101619583-101619605 TGGTGGACGTCTCTTTTTAGGGG - Intronic
1049221692 8:141431516-141431538 CCGTGGCCGTGTGTGTGGAGTGG + Exonic
1049347058 8:142144748-142144770 CAGTGGACTTGTCTGTGAAGTGG + Intergenic
1055762742 9:79626596-79626618 GCATGGAAGTCTCTGTATAGGGG - Intronic
1186131390 X:6469754-6469776 CCGTGGACATCTTTGGGTGGGGG - Intergenic