ID: 1143405809

View in Genome Browser
Species Human (GRCh38)
Location 17:6676615-6676637
Sequence TCTCACTAACTCCAGCGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143405809_1143405821 15 Left 1143405809 17:6676615-6676637 CCCTGACGCTGGAGTTAGTGAGA No data
Right 1143405821 17:6676653-6676675 GGGCTCTGTGAGAGGAGAGGGGG No data
1143405809_1143405819 13 Left 1143405809 17:6676615-6676637 CCCTGACGCTGGAGTTAGTGAGA No data
Right 1143405819 17:6676651-6676673 CAGGGCTCTGTGAGAGGAGAGGG No data
1143405809_1143405816 7 Left 1143405809 17:6676615-6676637 CCCTGACGCTGGAGTTAGTGAGA No data
Right 1143405816 17:6676645-6676667 CAGAGCCAGGGCTCTGTGAGAGG No data
1143405809_1143405814 -5 Left 1143405809 17:6676615-6676637 CCCTGACGCTGGAGTTAGTGAGA No data
Right 1143405814 17:6676633-6676655 TGAGAAGGAGGCCAGAGCCAGGG No data
1143405809_1143405820 14 Left 1143405809 17:6676615-6676637 CCCTGACGCTGGAGTTAGTGAGA No data
Right 1143405820 17:6676652-6676674 AGGGCTCTGTGAGAGGAGAGGGG No data
1143405809_1143405813 -6 Left 1143405809 17:6676615-6676637 CCCTGACGCTGGAGTTAGTGAGA No data
Right 1143405813 17:6676632-6676654 GTGAGAAGGAGGCCAGAGCCAGG No data
1143405809_1143405823 23 Left 1143405809 17:6676615-6676637 CCCTGACGCTGGAGTTAGTGAGA No data
Right 1143405823 17:6676661-6676683 TGAGAGGAGAGGGGGCAGGCCGG No data
1143405809_1143405818 12 Left 1143405809 17:6676615-6676637 CCCTGACGCTGGAGTTAGTGAGA No data
Right 1143405818 17:6676650-6676672 CCAGGGCTCTGTGAGAGGAGAGG No data
1143405809_1143405824 24 Left 1143405809 17:6676615-6676637 CCCTGACGCTGGAGTTAGTGAGA No data
Right 1143405824 17:6676662-6676684 GAGAGGAGAGGGGGCAGGCCGGG No data
1143405809_1143405822 19 Left 1143405809 17:6676615-6676637 CCCTGACGCTGGAGTTAGTGAGA No data
Right 1143405822 17:6676657-6676679 TCTGTGAGAGGAGAGGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143405809 Original CRISPR TCTCACTAACTCCAGCGTCA GGG (reversed) Intergenic
No off target data available for this crispr