ID: 1143411322

View in Genome Browser
Species Human (GRCh38)
Location 17:6711184-6711206
Sequence GAGGGTACACAGCACGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 164}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143411322_1143411343 23 Left 1143411322 17:6711184-6711206 CCCTGCCCGTGCTGTGTACCCTC 0: 1
1: 0
2: 1
3: 16
4: 164
Right 1143411343 17:6711230-6711252 GGCCATGGAGGGTGGGGGCAGGG 0: 1
1: 0
2: 5
3: 116
4: 1027
1143411322_1143411331 -2 Left 1143411322 17:6711184-6711206 CCCTGCCCGTGCTGTGTACCCTC 0: 1
1: 0
2: 1
3: 16
4: 164
Right 1143411331 17:6711205-6711227 TCTGGGTTTCCTTGCACAATGGG 0: 1
1: 0
2: 1
3: 7
4: 132
1143411322_1143411333 2 Left 1143411322 17:6711184-6711206 CCCTGCCCGTGCTGTGTACCCTC 0: 1
1: 0
2: 1
3: 16
4: 164
Right 1143411333 17:6711209-6711231 GGTTTCCTTGCACAATGGGGCGG 0: 1
1: 0
2: 1
3: 11
4: 129
1143411322_1143411330 -3 Left 1143411322 17:6711184-6711206 CCCTGCCCGTGCTGTGTACCCTC 0: 1
1: 0
2: 1
3: 16
4: 164
Right 1143411330 17:6711204-6711226 CTCTGGGTTTCCTTGCACAATGG 0: 1
1: 0
2: 0
3: 19
4: 218
1143411322_1143411339 16 Left 1143411322 17:6711184-6711206 CCCTGCCCGTGCTGTGTACCCTC 0: 1
1: 0
2: 1
3: 16
4: 164
Right 1143411339 17:6711223-6711245 ATGGGGCGGCCATGGAGGGTGGG 0: 1
1: 0
2: 0
3: 20
4: 225
1143411322_1143411340 17 Left 1143411322 17:6711184-6711206 CCCTGCCCGTGCTGTGTACCCTC 0: 1
1: 0
2: 1
3: 16
4: 164
Right 1143411340 17:6711224-6711246 TGGGGCGGCCATGGAGGGTGGGG 0: 1
1: 0
2: 3
3: 41
4: 525
1143411322_1143411336 11 Left 1143411322 17:6711184-6711206 CCCTGCCCGTGCTGTGTACCCTC 0: 1
1: 0
2: 1
3: 16
4: 164
Right 1143411336 17:6711218-6711240 GCACAATGGGGCGGCCATGGAGG 0: 1
1: 0
2: 1
3: 25
4: 372
1143411322_1143411332 -1 Left 1143411322 17:6711184-6711206 CCCTGCCCGTGCTGTGTACCCTC 0: 1
1: 0
2: 1
3: 16
4: 164
Right 1143411332 17:6711206-6711228 CTGGGTTTCCTTGCACAATGGGG 0: 1
1: 0
2: 2
3: 20
4: 175
1143411322_1143411338 15 Left 1143411322 17:6711184-6711206 CCCTGCCCGTGCTGTGTACCCTC 0: 1
1: 0
2: 1
3: 16
4: 164
Right 1143411338 17:6711222-6711244 AATGGGGCGGCCATGGAGGGTGG 0: 1
1: 0
2: 0
3: 31
4: 495
1143411322_1143411335 8 Left 1143411322 17:6711184-6711206 CCCTGCCCGTGCTGTGTACCCTC 0: 1
1: 0
2: 1
3: 16
4: 164
Right 1143411335 17:6711215-6711237 CTTGCACAATGGGGCGGCCATGG 0: 1
1: 0
2: 0
3: 8
4: 101
1143411322_1143411341 18 Left 1143411322 17:6711184-6711206 CCCTGCCCGTGCTGTGTACCCTC 0: 1
1: 0
2: 1
3: 16
4: 164
Right 1143411341 17:6711225-6711247 GGGGCGGCCATGGAGGGTGGGGG 0: 1
1: 0
2: 2
3: 49
4: 603
1143411322_1143411337 12 Left 1143411322 17:6711184-6711206 CCCTGCCCGTGCTGTGTACCCTC 0: 1
1: 0
2: 1
3: 16
4: 164
Right 1143411337 17:6711219-6711241 CACAATGGGGCGGCCATGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 119
1143411322_1143411342 22 Left 1143411322 17:6711184-6711206 CCCTGCCCGTGCTGTGTACCCTC 0: 1
1: 0
2: 1
3: 16
4: 164
Right 1143411342 17:6711229-6711251 CGGCCATGGAGGGTGGGGGCAGG 0: 1
1: 0
2: 13
3: 67
4: 633

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143411322 Original CRISPR GAGGGTACACAGCACGGGCA GGG (reversed) Intronic
900392168 1:2438464-2438486 GAGGGGACATGGCAGGGGCATGG - Intronic
900400771 1:2472043-2472065 GAGGGGTCCCAGCAAGGGCAGGG - Intronic
900754812 1:4426104-4426126 GAGGAGGCACAGCACGGGAAGGG - Intergenic
902820394 1:18939686-18939708 GAGGGTACGCAGCAAGGTAATGG + Intronic
902834866 1:19040471-19040493 GAGGGAACACAGGTCAGGCAGGG + Intergenic
903210119 1:21813343-21813365 GAAGGTACACAGGGCAGGCATGG - Intronic
903232400 1:21929916-21929938 GAGGGTCCAGAGCAAAGGCAAGG - Intronic
903704389 1:25274511-25274533 GAGGGTCCACAACCCAGGCAGGG + Intronic
903722851 1:25418804-25418826 GAGGGTCCACAACCCAGGCAGGG - Intronic
903742903 1:25568610-25568632 GTGGCTACAGAGCAGGGGCAAGG - Exonic
903838161 1:26219364-26219386 GAGGGAGCACAGCAGGGGCGGGG - Intergenic
907328747 1:53657881-53657903 GAGGGTGCAGAGAAGGGGCAAGG - Intronic
907732937 1:57085523-57085545 GGGGGTGCAAAGCACTGGCAAGG + Intronic
911247630 1:95535866-95535888 CAGAGAACACAGCACAGGCAGGG - Intergenic
913957295 1:143318112-143318134 GAGGGTCCAGGGCAAGGGCAAGG + Intergenic
914051609 1:144143476-144143498 GAGGGTCCAGGGCAAGGGCAAGG + Intergenic
914127588 1:144823065-144823087 GAGGGTCCAGGGCAAGGGCAAGG - Intergenic
914325020 1:146604558-146604580 CAGGGTACACAGCTCAGGCTTGG + Intergenic
915118596 1:153615111-153615133 GAGGCTACCTAGCACTGGCAAGG + Intronic
915592824 1:156880285-156880307 GAGGGGACACAGTGTGGGCACGG - Intronic
916211996 1:162367097-162367119 GGGGTCACAGAGCACGGGCAGGG - Exonic
919837238 1:201583270-201583292 GAGAGGAGACAGCAGGGGCAAGG + Intergenic
920138675 1:203791381-203791403 GAGGGGACTAAGCAAGGGCATGG - Intergenic
1066614998 10:37285147-37285169 GCGGGCACACAGCACGGGACTGG - Intronic
1066760363 10:38742483-38742505 GAGGGTCCAGGGCAAGGGCAAGG - Intergenic
1067344560 10:45428099-45428121 GAGGGGATTCTGCACGGGCAGGG - Intronic
1068142915 10:53028764-53028786 GTGGGTGCACGGCAGGGGCAAGG - Intergenic
1069788833 10:71006479-71006501 GAGGCCACACAGCTTGGGCAGGG + Intergenic
1069988251 10:72298474-72298496 GAGTGGACATGGCACGGGCAGGG + Intergenic
1072798033 10:98371686-98371708 GAGGGGACGCAACTCGGGCATGG - Intergenic
1073118689 10:101108200-101108222 GAGGGGTCACAGCAGGGGCAGGG + Intronic
1074703078 10:116109561-116109583 GGGGGAACACAGCCCGGGGAAGG - Intronic
1075162038 10:120032847-120032869 GAAGGAAAACAGCAGGGGCAAGG + Intergenic
1075791054 10:125084671-125084693 CAGGGGACACAGAACGGGCAAGG - Intronic
1080415824 11:32069054-32069076 GAGTGGACACAGCCCGTGCAGGG + Intronic
1081791991 11:45794771-45794793 GAGGGTACATAACCCAGGCAAGG - Intergenic
1083222754 11:61264353-61264375 GAGGGAACACGGCTCGCGCAAGG - Intronic
1084612432 11:70212181-70212203 GAGAGGAAACAGCAGGGGCAAGG - Intergenic
1088568157 11:111195131-111195153 CAGGGTATACAGGACAGGCAGGG - Intergenic
1089752306 11:120660494-120660516 GAGGGCACAGTGCACGGGCTGGG - Intronic
1092124061 12:6063576-6063598 GTGGGTACCCAGCACGTCCATGG - Intronic
1097171869 12:57119416-57119438 GAGGCTCCACAGCCTGGGCAAGG + Intronic
1097668179 12:62505393-62505415 TAGAGTACAAAGCAAGGGCATGG + Intronic
1101451834 12:104786942-104786964 GAGGTCAGACAGCACAGGCAGGG + Intergenic
1101469914 12:104986553-104986575 GAGGGTACGGAGCCCGGGCAGGG - Intronic
1103911772 12:124355921-124355943 GAGGGCACACAGCACAGGGAGGG - Intronic
1104460071 12:128948114-128948136 GAGGGGACACAGCCCAGCCAGGG - Intronic
1106204932 13:27584032-27584054 GAGGGTACACAGCACATTCAGGG + Intronic
1106415265 13:29541007-29541029 GAGTGTGCACAGAAGGGGCAGGG + Intronic
1116835700 14:49767773-49767795 GAGGGTTCACAGCCCGGGCAGGG - Exonic
1117788177 14:59309310-59309332 GAAGGTACACTTCACAGGCATGG + Intronic
1117998011 14:61496399-61496421 GAGGGAACTCAGCACCTGCATGG - Intronic
1118509354 14:66453958-66453980 GAGGGTAGAGAGCAAGGGGAGGG + Intergenic
1121006970 14:90496593-90496615 GAGGGTGCGCAGCAGGAGCAGGG - Intergenic
1121664002 14:95658219-95658241 GAGGACACAAAGCACCGGCAAGG - Intergenic
1121721025 14:96108665-96108687 ATGGGAACAGAGCACGGGCATGG + Intergenic
1122373602 14:101243285-101243307 GAGGGTGCACAGCGTGGGCGAGG - Intergenic
1124425656 15:29560507-29560529 CAGTGGACACAGCAAGGGCAGGG - Intronic
1127294353 15:57596705-57596727 GAGGGGAAACAGCACAGGCACGG - Intronic
1128728651 15:70006221-70006243 TAGGGCACACAGCCAGGGCAAGG + Intergenic
1129342055 15:74892568-74892590 GAGGGTGGACAGCAGGGGCTAGG + Intronic
1130396510 15:83507296-83507318 AAGTGTACACAGGCCGGGCACGG - Intronic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1133017663 16:2951756-2951778 GATGGGACACAGGACAGGCAGGG - Intergenic
1133025105 16:2985791-2985813 GAGGGGACACAGCACAGCCTCGG - Intergenic
1134533902 16:15008794-15008816 CAGGGTACACGGCACAAGCAGGG - Exonic
1136038642 16:27560603-27560625 CAGGGAACACAGCACAGGCAAGG - Intronic
1136076968 16:27823799-27823821 GAGGCCACACAGCACAGGGAAGG + Intronic
1136100053 16:27987467-27987489 CAGGGGGCACAGCAGGGGCAGGG - Intronic
1136722435 16:32336814-32336836 GAGGGTCCAGGGCAAGGGCAAGG + Intergenic
1136840749 16:33542786-33542808 GAGGGTCCAGGGCAAGGGCAAGG + Intergenic
1137988869 16:53131716-53131738 GAGGCGAGAAAGCACGGGCAGGG - Intronic
1138351390 16:56347918-56347940 GAAGATACTCAGCAGGGGCAGGG - Exonic
1139805238 16:69559740-69559762 GAGGCTAGACAGCCCGGGCACGG - Intergenic
1139862137 16:70031931-70031953 CAGGGTACACGGCACAAGCAGGG + Intergenic
1141642516 16:85349522-85349544 GAGTGTCCCCAGCAGGGGCAGGG + Intergenic
1141930848 16:87201782-87201804 GAGGGAACAGAACACAGGCAGGG - Intronic
1142224285 16:88870044-88870066 GAGGGTGGACAGCACAGGAAGGG - Intergenic
1142236251 16:88923971-88923993 GAGGGTGCACAGCCCGGCAAGGG + Intronic
1203003996 16_KI270728v1_random:180950-180972 GAGGGTCCAGGGCAAGGGCAAGG - Intergenic
1203135604 16_KI270728v1_random:1717357-1717379 GAGGGTCCAGGGCAAGGGCAAGG - Intergenic
1203150914 16_KI270728v1_random:1843083-1843105 GAGGGTCCAGGGCAAGGGCAAGG + Intergenic
1143411322 17:6711184-6711206 GAGGGTACACAGCACGGGCAGGG - Intronic
1143575203 17:7788252-7788274 GAGGACACAGACCACGGGCAGGG + Intronic
1146052180 17:29562900-29562922 GCAGATACACAGCACAGGCACGG + Exonic
1146833123 17:36087786-36087808 GAGGTTACACAGCACGTAAACGG - Intergenic
1146847648 17:36194408-36194430 GAGGTTACACAGCACGTAAACGG - Intronic
1147960182 17:44162524-44162546 GTGGCCACACAGCACTGGCAGGG - Intergenic
1149009097 17:51836502-51836524 GAGGTACCACAGCACAGGCACGG + Intronic
1152591792 17:81217183-81217205 GTGGGCACACAGCTGGGGCAAGG + Intronic
1152877213 17:82793725-82793747 GAGGGGCCACAGGACAGGCACGG - Intronic
1156352366 18:36312043-36312065 GAGGGTACAGGGCAGGGGGAAGG - Intronic
1159135312 18:64330489-64330511 GAGGGGACACAGCAAGGGTGGGG - Intergenic
1159260420 18:66005947-66005969 GTGGGTGCACAGCACGGGACTGG - Intergenic
1160876698 19:1299911-1299933 GAGGGTCCAGAGCACGGGGATGG - Exonic
1160897404 19:1409132-1409154 GAGGACTCACAGCACGGGCTAGG - Intronic
1161203174 19:3027524-3027546 GAGGGCACATAGCAGAGGCAGGG - Intronic
1161407488 19:4098703-4098725 GAGGGGACACAGCCCGGGAGGGG - Intronic
1162477298 19:10908211-10908233 GAGGCCACACAGCACAGGGAAGG + Intronic
1163703857 19:18800992-18801014 GAGGGGACGCAGCTGGGGCACGG - Intergenic
1164680887 19:30132954-30132976 GAAGGCACACAGCACCTGCAGGG - Intergenic
1168344405 19:55643373-55643395 GATGATAAAGAGCACGGGCACGG + Exonic
1202691006 1_KI270712v1_random:95900-95922 GAGGGTCCAGGGCAAGGGCAAGG + Intergenic
926148806 2:10413184-10413206 GGGGGTCCACAGGATGGGCAGGG - Intronic
928178713 2:29052820-29052842 GAGTGGGCACAGCACGGGCCAGG + Exonic
929979008 2:46661676-46661698 ATGGGTAAACAGCAAGGGCAGGG + Intergenic
933955388 2:87358051-87358073 GAGGGTCCAGGGCAAGGGCAAGG - Intergenic
934239573 2:90254262-90254284 GAGGGTCCAGGGCAAGGGCAAGG - Intergenic
934273619 2:91562479-91562501 GAGGGTCCAGGGCAAGGGCAAGG + Intergenic
934323679 2:91986807-91986829 GAGGGTCCAGGGCAAGGGCAAGG - Intergenic
934462013 2:94217602-94217624 GAGGGTCCAGGGCAAGGGCAAGG - Intergenic
938248870 2:129798492-129798514 GAGGGAACTGAGCCCGGGCAGGG + Intergenic
939275133 2:139990672-139990694 GTGGGCACACAGCACGGGATTGG - Intergenic
945967817 2:216207698-216207720 GAGGGGTCACAGCATGGGTACGG + Intergenic
948382739 2:237562110-237562132 TAGGGTAAGCAGCACGGGAAGGG - Intergenic
948443736 2:238015931-238015953 GGGGGTACACAGCATGTGGATGG + Intronic
1170588673 20:17754694-17754716 GAGGGGACACAGCACCTGCCTGG - Intergenic
1170761439 20:19254709-19254731 GAGGACACACAGCATGGGCTGGG + Intronic
1171849856 20:30300535-30300557 GTGGGGACACTGCAGGGGCAGGG + Intergenic
1174180316 20:48670304-48670326 CAGGGTTCTCAGCAGGGGCAGGG - Intronic
1174739891 20:53002296-53002318 AAGGGTCGACAGCACGGGCTTGG - Intronic
1175214025 20:57380701-57380723 GAAGGTAAACAGCAAGGGCCAGG + Intergenic
1176358854 21:5975697-5975719 GAGTGTACACAGCACTGGTTTGG + Intergenic
1176857592 21:13984917-13984939 CCAGGTCCACAGCACGGGCAGGG - Intergenic
1176867015 21:14059305-14059327 CCAGGTCCACAGCACGGGCAGGG + Intergenic
1179764664 21:43562853-43562875 GAGTGTACACAGCACTGGTTTGG - Intronic
1179884319 21:44306978-44307000 GAGGCTGCAGAGCACGGGCCTGG + Intronic
1179981684 21:44899250-44899272 GAGGGTTCGAAGCACGGGCAGGG - Intronic
1180971947 22:19820453-19820475 AAGGGTCCGCAGCAAGGGCAGGG - Intronic
1181354226 22:22289151-22289173 GAGGGTCCAGGGCAAGGGCAAGG + Intergenic
1184478827 22:44735771-44735793 GAGGGGACAGAGCTGGGGCAAGG + Intronic
1184810075 22:46825295-46825317 GAGGAAACACAGCACAGGCATGG - Intronic
1184891998 22:47385691-47385713 GAGGGTTCACAGCATTGGAACGG - Intergenic
952132002 3:30374684-30374706 GAGGGAACACAGGAGTGGCAGGG + Intergenic
954316588 3:49804771-49804793 GAGGGGGCCGAGCACGGGCACGG - Exonic
954609129 3:51935021-51935043 AAGGGCACACAGCCCGGACAAGG + Intronic
955758250 3:62249297-62249319 GAGGGCAGACAGGAGGGGCAGGG + Intronic
961859957 3:129908516-129908538 GAGTGTACACAGGCTGGGCAAGG + Intergenic
962950341 3:140212851-140212873 GGGGGCACACAGCTCAGGCATGG - Intronic
966862749 3:184239661-184239683 GAGGCAAGACAGCAGGGGCATGG - Intronic
966863549 3:184243805-184243827 GAGGGCAAACAGCAGGAGCAGGG + Exonic
967187318 3:186955789-186955811 GAGAGGACACAGGCCGGGCATGG - Intronic
968426074 4:524255-524277 GGGGGCACACAGCCCAGGCATGG - Intronic
968454080 4:688496-688518 GAGGGCACACAGGGCGGGAAAGG + Intronic
971473016 4:27047441-27047463 GATGGTGCACAGGCCGGGCATGG + Intergenic
974095028 4:57353511-57353533 GAGGGTAAACAGCATAGCCAAGG - Intergenic
976087388 4:81420181-81420203 GAGAGTTCACAGCACGGTGAAGG - Intergenic
977178274 4:93840921-93840943 CAGGGAACACAGCAGAGGCAGGG + Intergenic
985689767 5:1300671-1300693 GAGGGTCCTCAGCACGGGCTCGG + Intergenic
986178992 5:5376121-5376143 GAGGGTAAACAGCAAGAGCAAGG + Intergenic
989690613 5:44138688-44138710 GTGGGTACAAAGCACCAGCATGG + Intergenic
997472568 5:134124962-134124984 GAGGTCACACAGCAGGGGGAGGG - Intronic
999201640 5:149820795-149820817 GAGGTGACACAGCAAGGGCCAGG - Intronic
1000104943 5:158050559-158050581 GAGGGTACTTACCACGGGTAAGG + Intergenic
1002181415 5:177432924-177432946 CAGGTCACACAGCAGGGGCAAGG - Intronic
1002395971 5:178954892-178954914 GAGGCTACTCAGCAATGGCAAGG - Intronic
1021953819 7:25803461-25803483 GTGGGCACACAGCACCGGCCAGG - Intergenic
1027659143 7:80968044-80968066 GGGAATACACAGCAAGGGCAGGG - Intergenic
1029300060 7:99575246-99575268 GAAGATACACAGGCCGGGCATGG + Exonic
1040000939 8:42575588-42575610 GTGGGCACACAGCACGGGACTGG + Intergenic
1042525012 8:69755336-69755358 GTGGGTAGACAGCATGGGCCTGG + Intronic
1045267280 8:100630480-100630502 GAGGAGACAGAGCACTGGCAAGG - Intronic
1046075101 8:109304206-109304228 AAGGCTACACAGCACGGTCCCGG - Intronic
1047024850 8:120813235-120813257 GAGGGTAGACAGCAGTGGGAAGG - Exonic
1049248205 8:141574100-141574122 GAGGGTTCACAGCTCGGGGGAGG + Intergenic
1049275708 8:141719106-141719128 GCGGGTACACAGCAGGGCCTGGG + Intergenic
1049655470 8:143795122-143795144 GAGTGAACACAGCACTAGCAGGG + Intronic
1049791829 8:144475761-144475783 GACGGTAGACAGCGTGGGCAGGG + Exonic
1053073160 9:35112819-35112841 GGGGGTCCACAGCACAGGCAAGG - Intronic
1053307217 9:36993563-36993585 GAAGGGACACAGCAGGGGCAGGG + Intronic
1053435481 9:38070860-38070882 GAGGGCAGACAGCAAGGCCAGGG + Intergenic
1056794604 9:89648957-89648979 GAGGGTACACAGCATGGGAGTGG + Intergenic
1056795765 9:89657906-89657928 GCGGTGACACAGCATGGGCATGG - Intergenic
1057167624 9:92941139-92941161 GAGGGAAAACAGCAGGGGGAAGG + Intergenic
1189847987 X:45153891-45153913 GAAGGTACTCAGCATGGGCCTGG - Exonic
1197314570 X:124948992-124949014 GAAGTTACAGAGCAAGGGCATGG + Intronic
1200053201 X:153445513-153445535 GATGGTACACAGCAGGGCCCGGG - Intronic
1201191072 Y:11441726-11441748 GAGGGTTCAGGGCAAGGGCAAGG - Intergenic
1202278516 Y:23150604-23150626 GAGGGTGCAGAGCACCAGCATGG + Intronic
1202286687 Y:23258163-23258185 GAGGGTGCAGAGCACCAGCATGG - Intronic
1202431340 Y:24781942-24781964 GAGGGTGCAGAGCACCAGCATGG + Intronic
1202438628 Y:24876220-24876242 GAGGGTGCAGAGCACCAGCATGG - Intronic