ID: 1143411743

View in Genome Browser
Species Human (GRCh38)
Location 17:6713436-6713458
Sequence GACAACTCCGCCCCGCACGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 50}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143411737_1143411743 1 Left 1143411737 17:6713412-6713434 CCCGGGGATTGGGGAGGGGGCGG 0: 1
1: 0
2: 8
3: 95
4: 885
Right 1143411743 17:6713436-6713458 GACAACTCCGCCCCGCACGGGGG 0: 1
1: 0
2: 1
3: 2
4: 50
1143411724_1143411743 28 Left 1143411724 17:6713385-6713407 CCGCGGGCTTAAGAAGGGGCCAC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1143411743 17:6713436-6713458 GACAACTCCGCCCCGCACGGGGG 0: 1
1: 0
2: 1
3: 2
4: 50
1143411736_1143411743 2 Left 1143411736 17:6713411-6713433 CCCCGGGGATTGGGGAGGGGGCG 0: 1
1: 0
2: 5
3: 37
4: 396
Right 1143411743 17:6713436-6713458 GACAACTCCGCCCCGCACGGGGG 0: 1
1: 0
2: 1
3: 2
4: 50
1143411731_1143411743 9 Left 1143411731 17:6713404-6713426 CCACAGTCCCCGGGGATTGGGGA 0: 1
1: 0
2: 2
3: 14
4: 192
Right 1143411743 17:6713436-6713458 GACAACTCCGCCCCGCACGGGGG 0: 1
1: 0
2: 1
3: 2
4: 50
1143411739_1143411743 0 Left 1143411739 17:6713413-6713435 CCGGGGATTGGGGAGGGGGCGGT 0: 1
1: 0
2: 5
3: 51
4: 612
Right 1143411743 17:6713436-6713458 GACAACTCCGCCCCGCACGGGGG 0: 1
1: 0
2: 1
3: 2
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143411743 Original CRISPR GACAACTCCGCCCCGCACGG GGG Exonic
900092108 1:925072-925094 GACACCCCCGCCGCGCGCGGAGG + Intronic
902592544 1:17485389-17485411 GATAAGTCGGCCACGCACGGCGG - Intergenic
903126411 1:21251222-21251244 AACAACTGCGCCGGGCACGGTGG + Intronic
905126459 1:35718972-35718994 GTCAACGCGGCCCCGCGCGGGGG - Exonic
910183039 1:84506157-84506179 GACAACTCAGCGGCGCGCGGCGG + Exonic
919713609 1:200752902-200752924 GACAACTAGGCCAGGCACGGTGG - Intronic
923786348 1:237072140-237072162 GACAACTCAGCAGGGCACGGGGG + Intronic
924540031 1:244971313-244971335 GACCACCCAGCCCCGCGCGGTGG + Intronic
1062892691 10:1076390-1076412 TACAACTCGGCCACGCGCGGTGG + Intronic
1064204462 10:13311548-13311570 GTCAATTCCGCCGGGCACGGTGG + Intergenic
1083483387 11:62964922-62964944 GAAAACTGGGCCCAGCACGGTGG - Intronic
1106057623 13:26253830-26253852 TACGACTCCGCCCCACACGGTGG - Intergenic
1111997600 13:95180264-95180286 GACAACGCGGCCAGGCACGGTGG + Intronic
1115261316 14:31457229-31457251 GAAAAAACCGCCCCGCACGCCGG + Intronic
1123088657 14:105731673-105731695 GACAATGCTGCCACGCACGGGGG - Intergenic
1133032914 16:3020296-3020318 GAGAGCTCCGCCCCGGAAGGCGG + Exonic
1133053595 16:3133427-3133449 GAAAATTCCGCCAGGCACGGTGG + Intronic
1143411743 17:6713436-6713458 GACAACTCCGCCCCGCACGGGGG + Exonic
1143749042 17:9015121-9015143 GAAAACTCAGCCAGGCACGGTGG + Intergenic
1144220072 17:13091892-13091914 GACCACTCTGCCGGGCACGGTGG + Intergenic
1145885753 17:28381423-28381445 GGCAACTGCGCGCTGCACGGGGG + Exonic
1148406796 17:47423435-47423457 GCCAACTCCGCCCCGGGCCGCGG - Intronic
1151698865 17:75731975-75731997 TACAACGCAGCCCCGCAGGGCGG + Intronic
1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG + Intronic
1161128044 19:2571087-2571109 GACAACTCCGCCGGGCACGGTGG - Intronic
1165219682 19:34305077-34305099 GACAAGCCCGCCGGGCACGGTGG - Intronic
1165504345 19:36215305-36215327 CCCATCTCCGCCCCGCACGTAGG - Intronic
1168154076 19:54463558-54463580 GACGAGGTCGCCCCGCACGGAGG + Exonic
929779611 2:44949350-44949372 GGCATCTCCGCCCCGCGCCGTGG - Intergenic
936038216 2:109129245-109129267 CGCAAGTCCGCCCCGCGCGGGGG - Intergenic
1175957819 20:62620740-62620762 GTCAAGTCCGCCCCTCATGGTGG - Intergenic
1178239608 21:30883546-30883568 TACAACTCAGCCGGGCACGGTGG + Intergenic
1179885629 21:44313176-44313198 GGCCCCTCCTCCCCGCACGGTGG + Intronic
1180170676 21:46056694-46056716 GATGACTAAGCCCCGCACGGAGG - Intergenic
1183372435 22:37441461-37441483 GTCAACTCTGCCCCTCACGAAGG + Intergenic
955188211 3:56734994-56735016 TACAACTCAGCCAGGCACGGTGG + Intronic
960578795 3:119255877-119255899 GACATCTCCGCCGGGCGCGGTGG + Intergenic
965067780 3:163874753-163874775 GAGAACCCCGCCCCTCATGGAGG - Intergenic
968022310 3:195404051-195404073 GAAAACCAGGCCCCGCACGGTGG + Intronic
968939717 4:3631477-3631499 CACACCTCCACCCCGCAAGGGGG - Intergenic
978169127 4:105648173-105648195 GACAACTCAGCCGGGCACGGTGG - Intronic
985492073 5:186006-186028 GACACCTCAGCCCTGCAGGGTGG - Exonic
1005583144 6:27251744-27251766 GACACCGCCGCCCGGCACTGTGG - Exonic
1009440347 6:63670571-63670593 AACACCTCCGCCGGGCACGGTGG - Intronic
1019464688 7:1181226-1181248 GTCCACTCAGCCCAGCACGGCGG + Intergenic
1019940294 7:4284014-4284036 TACAACTCGGCCGGGCACGGTGG + Intergenic
1020043398 7:5021219-5021241 GACAACCCGGCGCCGCACCGTGG - Intronic
1028471128 7:91207667-91207689 GACAACTTGGCCCCGGACTGTGG + Exonic
1034138541 7:148795118-148795140 AACAACTCTGCCAGGCACGGTGG - Intronic
1034456343 7:151173047-151173069 GAGGACTCCGCCCTGCACTGAGG - Intronic
1049619535 8:143591832-143591854 GACAGCTCAGCACCCCACGGGGG - Intronic
1055397460 9:75890794-75890816 GTCATCTCCGCCGCGCTCGGGGG + Exonic
1187008285 X:15253302-15253324 CAAAACTCCGCCGGGCACGGTGG + Intronic
1200233621 X:154458214-154458236 GACGCCCCCGCCCCGCGCGGTGG + Intergenic