ID: 1143413612

View in Genome Browser
Species Human (GRCh38)
Location 17:6728605-6728627
Sequence CACTGCAGGCTGAAGTGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143413607_1143413612 13 Left 1143413607 17:6728569-6728591 CCTGGCGGCTGGAAGCTGAGTTC No data
Right 1143413612 17:6728605-6728627 CACTGCAGGCTGAAGTGCTCTGG No data
1143413606_1143413612 17 Left 1143413606 17:6728565-6728587 CCATCCTGGCGGCTGGAAGCTGA No data
Right 1143413612 17:6728605-6728627 CACTGCAGGCTGAAGTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143413612 Original CRISPR CACTGCAGGCTGAAGTGCTC TGG Intergenic
No off target data available for this crispr