ID: 1143417084

View in Genome Browser
Species Human (GRCh38)
Location 17:6758179-6758201
Sequence GCTCCTCCATGGTTTCCTTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 156}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143417084_1143417091 12 Left 1143417084 17:6758179-6758201 CCCCAAGGAAACCATGGAGGAGC 0: 1
1: 0
2: 1
3: 20
4: 156
Right 1143417091 17:6758214-6758236 AGCACCAGCAGGTGAGGAGGCGG 0: 1
1: 0
2: 5
3: 55
4: 558
1143417084_1143417098 26 Left 1143417084 17:6758179-6758201 CCCCAAGGAAACCATGGAGGAGC 0: 1
1: 0
2: 1
3: 20
4: 156
Right 1143417098 17:6758228-6758250 AGGAGGCGGCAGGGAGGATGGGG 0: 1
1: 0
2: 10
3: 133
4: 1421
1143417084_1143417090 9 Left 1143417084 17:6758179-6758201 CCCCAAGGAAACCATGGAGGAGC 0: 1
1: 0
2: 1
3: 20
4: 156
Right 1143417090 17:6758211-6758233 TTGAGCACCAGCAGGTGAGGAGG 0: 1
1: 0
2: 0
3: 22
4: 240
1143417084_1143417088 1 Left 1143417084 17:6758179-6758201 CCCCAAGGAAACCATGGAGGAGC 0: 1
1: 0
2: 1
3: 20
4: 156
Right 1143417088 17:6758203-6758225 CTGCAAGCTTGAGCACCAGCAGG 0: 1
1: 0
2: 0
3: 17
4: 140
1143417084_1143417094 17 Left 1143417084 17:6758179-6758201 CCCCAAGGAAACCATGGAGGAGC 0: 1
1: 0
2: 1
3: 20
4: 156
Right 1143417094 17:6758219-6758241 CAGCAGGTGAGGAGGCGGCAGGG 0: 1
1: 1
2: 3
3: 82
4: 619
1143417084_1143417097 25 Left 1143417084 17:6758179-6758201 CCCCAAGGAAACCATGGAGGAGC 0: 1
1: 0
2: 1
3: 20
4: 156
Right 1143417097 17:6758227-6758249 GAGGAGGCGGCAGGGAGGATGGG 0: 1
1: 0
2: 6
3: 131
4: 1045
1143417084_1143417096 24 Left 1143417084 17:6758179-6758201 CCCCAAGGAAACCATGGAGGAGC 0: 1
1: 0
2: 1
3: 20
4: 156
Right 1143417096 17:6758226-6758248 TGAGGAGGCGGCAGGGAGGATGG 0: 1
1: 1
2: 17
3: 178
4: 2206
1143417084_1143417093 16 Left 1143417084 17:6758179-6758201 CCCCAAGGAAACCATGGAGGAGC 0: 1
1: 0
2: 1
3: 20
4: 156
Right 1143417093 17:6758218-6758240 CCAGCAGGTGAGGAGGCGGCAGG 0: 1
1: 0
2: 4
3: 56
4: 585
1143417084_1143417095 20 Left 1143417084 17:6758179-6758201 CCCCAAGGAAACCATGGAGGAGC 0: 1
1: 0
2: 1
3: 20
4: 156
Right 1143417095 17:6758222-6758244 CAGGTGAGGAGGCGGCAGGGAGG 0: 1
1: 0
2: 5
3: 103
4: 941
1143417084_1143417089 6 Left 1143417084 17:6758179-6758201 CCCCAAGGAAACCATGGAGGAGC 0: 1
1: 0
2: 1
3: 20
4: 156
Right 1143417089 17:6758208-6758230 AGCTTGAGCACCAGCAGGTGAGG 0: 1
1: 0
2: 1
3: 28
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143417084 Original CRISPR GCTCCTCCATGGTTTCCTTG GGG (reversed) Exonic
900236951 1:1597530-1597552 GCTCTTCCAGGCTGTCCTTGAGG - Intergenic
900646437 1:3710892-3710914 CCTCCTCCTGGGTTTCCATGGGG - Intronic
905149327 1:35914831-35914853 GCTTATCCCTGTTTTCCTTGTGG + Intronic
906766971 1:48442376-48442398 GTAACTCCATGATTTCCTTGTGG - Intronic
908323942 1:63005107-63005129 GCTGCTCCCTGATTTCCTTCTGG - Intergenic
915545957 1:156597976-156597998 TCTCTTCCCTGGTTTCCCTGGGG - Intronic
917967704 1:180188900-180188922 CCTCCTCCCTGGAGTCCTTGTGG + Intronic
919257201 1:195140087-195140109 GTAACTCCATGATTTCCTTGTGG - Intergenic
920351964 1:205343595-205343617 GCACCTCCATGGCAGCCTTGGGG + Exonic
921406693 1:214788144-214788166 CCTCCTCCATGATGTCTTTGAGG - Intergenic
922182824 1:223248902-223248924 GCTCCTCTGTGGCTTCCTTGTGG - Intronic
1067223667 10:44361812-44361834 GCTTCTCCAGGCTTTCCTGGAGG + Intergenic
1067799720 10:49350685-49350707 CCTCCTCCATGCTGTCCCTGAGG - Intergenic
1067905878 10:50290436-50290458 TCACCTCCATGCCTTCCTTGAGG + Intergenic
1072692448 10:97580893-97580915 GCTTCTCCAGGATTTCCATGTGG - Exonic
1074011120 10:109481087-109481109 TCTTCTCCATTGTTTGCTTGAGG - Intergenic
1075096158 10:119472943-119472965 CTTCCTCCATGGTTTCCAGGTGG + Intergenic
1075146745 10:119888792-119888814 ACAACTCCATGATTTCCTTGTGG - Intronic
1076585858 10:131547258-131547280 ACTCCTCCATGGATTCCTGAAGG + Intergenic
1079649039 11:22903395-22903417 GCACCTCCATGATTCCCTAGAGG - Intergenic
1083247264 11:61438742-61438764 GCTCCTCAATAGTTTCATTCTGG + Intronic
1085113301 11:73907726-73907748 CCTCCCCCATGGTTTCAGTGGGG - Intronic
1085726030 11:78955421-78955443 TCTGCTCCATGGATCCCTTGTGG - Intronic
1088891130 11:114045069-114045091 TCCCCTCCTTGGGTTCCTTGTGG - Intergenic
1089041210 11:115451947-115451969 GGTCCTCCATTCTTGCCTTGAGG - Intronic
1094319586 12:29170917-29170939 ACAACTCCATGATTTCCTTGTGG + Intronic
1094775742 12:33725320-33725342 GTTCCTCTTTGATTTCCTTGAGG - Intergenic
1097792920 12:63833760-63833782 GCGTCACCATTGTTTCCTTGGGG - Intergenic
1099376671 12:81901736-81901758 ACAACTCCATGATTTCCTTGTGG - Intergenic
1103561567 12:121795636-121795658 GCTCCTCCCTGGTCACCCTGAGG - Intronic
1105762918 13:23530136-23530158 GTAACTCCATGATTTCCTTGTGG - Intergenic
1106083800 13:26522610-26522632 TATCCTCCATGGCTTTCTTGTGG - Intergenic
1110593461 13:77291864-77291886 GGTCAATCATGGTTTCCTTGGGG - Intronic
1112810737 13:103215674-103215696 GCTCCTCTCTTGTATCCTTGAGG - Intergenic
1113706437 13:112436291-112436313 GCTCTGCCAAGGTTTCCTGGGGG - Intergenic
1114034000 14:18604062-18604084 GCTGGTTAATGGTTTCCTTGGGG + Intergenic
1114078795 14:19183235-19183257 GCTGGTTAATGGTTTCCTTGGGG + Intergenic
1114124645 14:19710949-19710971 GCTGGTTAATGGTTTCCTTGGGG - Intergenic
1116862746 14:50007623-50007645 GGGCCTCAATGTTTTCCTTGAGG + Intergenic
1117445226 14:55797909-55797931 ACTCCTCCATGGCTTCCTGTTGG + Intergenic
1118234832 14:63992821-63992843 TCTCCTCCAAGGCCTCCTTGAGG - Intronic
1118320057 14:64747757-64747779 GGACTTTCATGGTTTCCTTGGGG + Exonic
1119381312 14:74230703-74230725 GCTTCTCCATGGTATCACTGAGG + Intergenic
1119435996 14:74598230-74598252 GCTCCTCCTTGGCTTCCTTGAGG - Intronic
1120932121 14:89859411-89859433 TCTCCTCCGTGAGTTCCTTGAGG - Intronic
1121756892 14:96410575-96410597 ACTGCTCCATGTTTTCTTTGGGG - Intronic
1122772578 14:104103910-104103932 GGTCCTCCATGCTTTTCTAGAGG + Intronic
1124244075 15:28055524-28055546 GCTCCTAGATGGTTTGTTTGGGG + Intronic
1125208245 15:37179829-37179851 GCACCTTCATGGATTCCTTAGGG + Intergenic
1125697093 15:41647928-41647950 GCCCCTCCATGGATTCCCTGTGG + Intronic
1128343152 15:66836720-66836742 TCTACTGCCTGGTTTCCTTGGGG + Intergenic
1129779807 15:78263362-78263384 TCTCCTCCATGTGTTCCATGGGG - Intergenic
1133146189 16:3788382-3788404 GCACCTCTATGGCTTCCCTGAGG + Intronic
1136028450 16:27485266-27485288 GCTCCTCCAAAGCTGCCTTGTGG + Intronic
1136232574 16:28895219-28895241 GCTCCTGGATGGGTCCCTTGTGG - Intronic
1142128393 16:88421320-88421342 GCTCCTCCGGGGTCTCCCTGGGG + Intergenic
1142527016 17:550220-550242 ACTCCTCCAGGGTTTCCTTTGGG - Intronic
1143281272 17:5756365-5756387 GCTCCTCCATTCTTTGCTTGTGG + Intergenic
1143417084 17:6758179-6758201 GCTCCTCCATGGTTTCCTTGGGG - Exonic
1146436594 17:32855153-32855175 TTTCCTCCATGATTTCCTTGAGG + Intronic
1147187802 17:38722117-38722139 GCCCCTCAATGGGCTCCTTGGGG + Exonic
1150283202 17:63941172-63941194 TCTCCTCCATGGTCTGCTTGAGG + Exonic
1151497261 17:74466333-74466355 ACTCCTCCCTCCTTTCCTTGTGG - Intergenic
1153621434 18:6982138-6982160 GCTCCTCTAGTTTTTCCTTGAGG - Intronic
1156445965 18:37236970-37236992 GCCCCTCCTTGGTTCCCATGAGG + Intergenic
1157105429 18:44770313-44770335 GCACCTCCTTGGTTTGCCTGAGG + Intronic
1158515143 18:58124399-58124421 GCTCCTCCTTGGTCTCCCTCTGG + Intronic
1161688154 19:5714065-5714087 GGTCTTCCCTGGTTTCCTCGGGG + Intronic
1162108329 19:8384759-8384781 ATAACTCCATGGTTTCCTTGTGG - Intronic
1163885780 19:19963546-19963568 GCTCCTCTAATGTTTCTTTGGGG + Intergenic
1164408373 19:27975459-27975481 GCTGCTCCAGTGTTTCCTTGAGG + Intergenic
1166250976 19:41570657-41570679 GCTCCTCCCTGGGGTCCCTGAGG + Intronic
1167446216 19:49539112-49539134 GGTCCTCCAGGGTTTCCTGGAGG - Exonic
925949459 2:8897398-8897420 ATAACTCCATGGTTTCCTTGTGG + Intronic
926046003 2:9710069-9710091 GCTCCTTCATGGACTCCGTGAGG + Intergenic
929955362 2:46454128-46454150 GCTCCTCAATGGTCTCCTCAAGG + Intronic
931285710 2:60829937-60829959 GCTCCGTCATCGTTTCCTTGGGG - Intergenic
934557713 2:95296295-95296317 GCTCCTGAGTGGTTTGCTTGGGG + Intergenic
936906862 2:117546351-117546373 TTTCCTCCATGCTTTTCTTGTGG + Intergenic
937000861 2:118466385-118466407 CCTCCTACTTGCTTTCCTTGGGG - Intergenic
938709326 2:133962314-133962336 GCTCATTCTTGGTTTTCTTGAGG - Intergenic
938966990 2:136397473-136397495 GCTCCTCCTGCCTTTCCTTGTGG + Intergenic
942139286 2:172961296-172961318 GCTTCTCCCTGTTTTCCATGTGG + Intronic
943678913 2:190747064-190747086 GCTTCTCCTTGTTTTCCTCGTGG + Intergenic
944097189 2:195981861-195981883 GTTTCTCCAATGTTTCCTTGTGG - Intronic
945307921 2:208276800-208276822 TCCCCTCCATGATTTCCTTGAGG - Exonic
946041554 2:216786987-216787009 GCTGCTTCATGTTTTCCTTAAGG - Intergenic
946047678 2:216834758-216834780 TCTCCTCTATGGCTCCCTTGTGG + Intergenic
946410839 2:219514466-219514488 TCTCCTCGATCGTCTCCTTGTGG - Exonic
1172083407 20:32359219-32359241 GCTCCTCCCTCGCTTCCTGGTGG + Intronic
1173028840 20:39335638-39335660 GATCATCACTGGTTTCCTTGTGG + Intergenic
1174266663 20:49336898-49336920 GCTCCTCCCTCATTTCCTTTGGG - Intergenic
1175603669 20:60295468-60295490 GCTCCTGCATGGCTGCCCTGGGG - Intergenic
1180458119 22:15531104-15531126 GCTGGTTAATGGTTTCCTTGGGG + Intergenic
1180784535 22:18539464-18539486 GCTCCTCCTTGGCCTCCTTGGGG - Intergenic
1181128112 22:20713517-20713539 GCTCCTCCTTGGCCTCCTTGGGG - Intronic
1181241438 22:21478821-21478843 GCTCCTCCTTGGCCTCCTTGGGG - Intergenic
1181309504 22:21937009-21937031 GAGCCCCCATGGTTTCCTTTGGG - Intronic
1182552193 22:31106506-31106528 GCTCCTCCCTGCCTTCCCTGAGG + Intronic
1185389599 22:50551879-50551901 GCACCTCTATGCTTTCGTTGAGG + Intronic
950168934 3:10822903-10822925 GATCGTCCATGGTGACCTTGGGG - Intronic
950463921 3:13142111-13142133 TCCCCTCCATGGGTGCCTTGTGG + Intergenic
952748133 3:36801324-36801346 CTTCCTCCATGGTTTCTTTCTGG - Intergenic
952848828 3:37711323-37711345 TCTCCTGGATGGTTTCATTGGGG - Intronic
952854267 3:37754963-37754985 GCTCCTCCAGGTCATCCTTGGGG - Intronic
954325062 3:49859080-49859102 GCCCCTGCATGGATTCCTTGTGG - Exonic
954748535 3:52800755-52800777 GCTCTTCCCTGGGTTCCCTGTGG + Intronic
956079898 3:65547539-65547561 ACTTCTCCATGGTTTCATTCTGG - Intronic
956842674 3:73155110-73155132 ATAACTCCATGGTTTCCTTGTGG + Intergenic
956916556 3:73878011-73878033 GCTACTCCAGAGTTTCCTTTTGG - Intergenic
961216740 3:125165634-125165656 GCTCATCCATGGGTGCCTGGAGG - Intronic
962196873 3:133371525-133371547 GCTACTTCTTGGTTTTCTTGTGG - Intronic
963021536 3:140876715-140876737 ATAACTCCATGGTTTCCTTGTGG - Intergenic
964330567 3:155597761-155597783 GTTCCTCCTTGATTTCTTTGAGG - Intronic
966993532 3:185257817-185257839 TCTCCTCCAGGCTTTGCTTGTGG - Intronic
967584075 3:191191042-191191064 ATAACTCCATGGTTTCCTTGTGG - Intergenic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
975088019 4:70366704-70366726 CCTCCACCATGTTTTCCTTTTGG + Exonic
975429904 4:74277056-74277078 GCTCCTCCATGCTGTCCTCATGG - Intronic
977384769 4:96325089-96325111 GATTCTTCATGCTTTCCTTGAGG + Intergenic
979439519 4:120734678-120734700 GCTCCTTCCTGGTTTCCTTTTGG + Intronic
982701540 4:158663291-158663313 ATAACTCCATGGTTTCCTTGTGG - Intergenic
983632857 4:169867142-169867164 GCTCCCTCCTGGTTTCCATGGGG - Intergenic
984183637 4:176515394-176515416 GATGCCCCAGGGTTTCCTTGAGG - Intergenic
986933574 5:12855781-12855803 GTAACTCCATGATTTCCTTGTGG - Intergenic
987065852 5:14288879-14288901 CCCCCTCCATGTTTTCCTTGAGG + Intronic
987818427 5:22932517-22932539 CCTCATCTATGGATTCCTTGTGG + Intergenic
988591602 5:32554557-32554579 GTAACTCCATGATTTCCTTGTGG + Intronic
989701310 5:44268565-44268587 CCTCCTCCAGGGTTTCTGTGTGG - Intergenic
992002302 5:72447547-72447569 GCTCCTTCCTGATTTCCTTATGG - Intronic
999827804 5:155290821-155290843 TTTCTTCCATGGTTTCATTGGGG + Intergenic
1000633260 5:163615200-163615222 TCTCCTCCCTAGTTTCCTGGTGG + Intergenic
1000946622 5:167429945-167429967 TCTTCTCCCAGGTTTCCTTGTGG - Intronic
1004531961 6:16462156-16462178 CCTCATCTATGGATTCCTTGTGG + Intronic
1006075364 6:31529119-31529141 GCTCTTCCATGCTTGCTTTGGGG - Exonic
1007030437 6:38621711-38621733 GTAACTCCATGATTTCCTTGTGG - Intronic
1012011345 6:93790005-93790027 GTACCTCCATGCTTTCTTTGTGG + Intergenic
1017634507 6:156430821-156430843 GCTCCGCCAGGCTTTCCCTGAGG - Intergenic
1017931127 6:158956695-158956717 GCTCCCTCATGGGTTCTTTGAGG - Intergenic
1018943962 6:168332367-168332389 GCTTCTCCATGGGCTGCTTGTGG + Intergenic
1022020623 7:26397375-26397397 GCTCCTCCGTGGTTGCCAGGTGG + Intergenic
1023629100 7:42145868-42145890 CCTGCTCCATGGTGTTCTTGTGG - Intronic
1023811961 7:43918791-43918813 ACTCCTCCATGGTGCCCTTGGGG - Intronic
1024997230 7:55281116-55281138 GAGACTCCAGGGTTTCCTTGTGG + Intergenic
1027749365 7:82122753-82122775 GCTACTACATGGTTTCCATGGGG - Intronic
1034429979 7:151036371-151036393 ACGCCTCCATGGCCTCCTTGAGG - Intronic
1034549039 7:151808795-151808817 GCTCCTCCCTGGCTGCCTGGAGG - Intronic
1034579571 7:152030961-152030983 ATAACTCCATGGTTTCCTTGTGG + Intronic
1034852527 7:154508339-154508361 GTTCCTCCATGGAGTCCTTCAGG + Intronic
1035101641 7:156402350-156402372 GCTTCCCCGTGGTCTCCTTGGGG - Intergenic
1035297901 7:157877284-157877306 GCAGCACCAGGGTTTCCTTGGGG + Intronic
1036446367 8:8824831-8824853 CCTCCTTCCTGGGTTCCTTGGGG - Intronic
1036631899 8:10521787-10521809 GCTCTTCCATGGTTCCCTGCTGG + Intergenic
1036972280 8:13368446-13368468 AGTCCTTCATGATTTCCTTGGGG - Intronic
1037466955 8:19170342-19170364 TTTCCTTCATGGTTTCCTTCTGG + Intergenic
1037526022 8:19724988-19725010 TCTCCTCCCTGGCTTCATTGTGG + Intronic
1041990577 8:63985714-63985736 GTTCTTTCATGTTTTCCTTGGGG + Intergenic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1045390000 8:101705727-101705749 TCTCCTCCATGGTGGCTTTGGGG - Intronic
1046324396 8:112621543-112621565 GGTCACCAATGGTTTCCTTGTGG + Intronic
1049046475 8:140155956-140155978 TCCCCTCCATGTGTTCCTTGTGG - Intronic
1049589603 8:143451079-143451101 GCCCCTCCCTGCTGTCCTTGTGG - Intronic
1049780504 8:144426535-144426557 GCTCCACCATGGCTCCCTGGCGG + Intronic
1050202389 9:3159430-3159452 GTTTATCCATGGTTTGCTTGAGG + Intergenic
1056832422 9:89928058-89928080 CCAACTCCATGGTTTCCTTGGGG - Intergenic
1057733656 9:97633432-97633454 GCTTCTCAATGGTTTCCCGGTGG - Exonic
1061095144 9:128452318-128452340 ACTCGACCATGGATTCCTTGTGG - Intergenic
1061677617 9:132227361-132227383 GCTCCTCTCGGGTTTCCCTGTGG - Intronic
1061897993 9:133658467-133658489 CCTCCTCCATGCTGTCCCTGTGG + Exonic
1062647298 9:137555193-137555215 TCTCCCTCCTGGTTTCCTTGTGG + Exonic
1185923851 X:4124784-4124806 GCTCCTTGAGGGTTTTCTTGAGG + Intergenic
1186586651 X:10882208-10882230 GGTCCTCCATGGATTCATGGAGG + Intergenic
1188262111 X:28034359-28034381 GCTCCTCCCTGGTATCCTGGAGG - Intergenic
1190922234 X:54864731-54864753 GATCCTTCCTGCTTTCCTTGTGG - Intergenic
1192162693 X:68800446-68800468 CCTCCTCATTGGTTTCCCTGAGG + Intergenic
1198402032 X:136277859-136277881 GCTCCTCTAAGGTTTCCTATTGG - Intergenic
1200146722 X:153930227-153930249 GCTTCTCCCTGGGTTCCTGGTGG - Intronic
1201455484 Y:14163537-14163559 GTAACTCCATGATTTCCTTGTGG - Intergenic