ID: 1143417964

View in Genome Browser
Species Human (GRCh38)
Location 17:6763821-6763843
Sequence GAGATGCGCTGCCCCAGCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 200}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143417963_1143417964 -6 Left 1143417963 17:6763804-6763826 CCAGGCATTTCAAGTCTGAGATG 0: 1
1: 0
2: 0
3: 16
4: 165
Right 1143417964 17:6763821-6763843 GAGATGCGCTGCCCCAGCCACGG 0: 1
1: 0
2: 1
3: 11
4: 200
1143417962_1143417964 -5 Left 1143417962 17:6763803-6763825 CCCAGGCATTTCAAGTCTGAGAT 0: 1
1: 0
2: 0
3: 11
4: 178
Right 1143417964 17:6763821-6763843 GAGATGCGCTGCCCCAGCCACGG 0: 1
1: 0
2: 1
3: 11
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143417964 Original CRISPR GAGATGCGCTGCCCCAGCCA CGG Intronic
901299576 1:8189661-8189683 CAGAGCCCCTGCCCCAGCCATGG + Intergenic
902932327 1:19740412-19740434 GAGCTGAGTTGCCCCAGACAAGG + Intronic
904534819 1:31192312-31192334 GACATGCCCTCACCCAGCCAGGG + Intronic
905478868 1:38247674-38247696 GAGCTGCCCTGACCCAGCCCTGG + Intergenic
905886493 1:41494729-41494751 GAGATCCACAGCCCCAGCCCTGG - Intergenic
907069261 1:51519211-51519233 GAGCTGGGCCGCCGCAGCCATGG + Exonic
907424141 1:54368402-54368424 GAGATGCTATGCTGCAGCCAGGG + Intronic
911196445 1:94999891-94999913 GAGATGGCCTGCGCCAGGCAGGG - Intronic
911530394 1:99036903-99036925 CAGCTGCTCTGCTCCAGCCATGG - Intergenic
911824555 1:102465035-102465057 GAGTTTTGCTGCCACAGCCAAGG - Intergenic
912796246 1:112695340-112695362 GACTTGCCCTGCCCCAGCCTGGG + Intronic
916679178 1:167088838-167088860 GAGAATCACTGGCCCAGCCAGGG + Intronic
920900669 1:210107149-210107171 GAGATGGGCTCCCACAGCCTTGG + Intronic
921199629 1:212792396-212792418 GAGATGCGCAGCGCCCGCCTCGG - Intronic
924225414 1:241917769-241917791 GAGAAATGCTGCACCAGCCAGGG - Intergenic
1066617015 10:37305501-37305523 GAGATGCTCTGTTCCATCCAGGG + Intronic
1067049439 10:43004004-43004026 GACAAGCACCGCCCCAGCCAGGG - Intergenic
1070523566 10:77275816-77275838 GGGAGGCCCAGCCCCAGCCAAGG + Intronic
1071733610 10:88272999-88273021 GTGATGCTGTGGCCCAGCCAGGG + Intergenic
1074078493 10:110150407-110150429 CAGGTGCGCTGCTCCAGCCAGGG - Intergenic
1074420366 10:113303375-113303397 GAGTTACACTGCCCCAGCCAAGG - Intergenic
1076194863 10:128510603-128510625 GAGATGTGCAGCTACAGCCAAGG + Intergenic
1076379508 10:130015463-130015485 AAGAGCCGCTGCCCCAGCCGTGG + Intergenic
1076422078 10:130338830-130338852 AAGATGCGGTGCCCCAGCTGGGG + Intergenic
1076658005 10:132037025-132037047 GAGATGCGGGTCCCCAGCCCTGG - Intergenic
1076694213 10:132239342-132239364 GAGATGGGCTCCCCCAGCTTGGG - Intronic
1077239689 11:1504034-1504056 GGAACGAGCTGCCCCAGCCAGGG - Intergenic
1081757279 11:45553866-45553888 GAGGTGAGCTGTTCCAGCCACGG - Intergenic
1085404229 11:76252344-76252366 AAGATGCAATGCCCCGGCCAGGG - Intergenic
1085510915 11:77087807-77087829 GAGATGGGATGTCCCAACCAAGG - Intronic
1088582267 11:111327807-111327829 GAGATGAGGTGGCCCACCCAGGG + Intergenic
1091001801 11:131916111-131916133 GAGGGGCTCTGCTCCAGCCACGG - Intronic
1092245929 12:6864195-6864217 GGTATGGGCTGCCCCAGCTAAGG + Exonic
1093677668 12:21962753-21962775 GATATGCCCTGCCCCAGAGATGG - Intergenic
1094397557 12:30024635-30024657 GAGGTGGGCTTCCACAGCCATGG + Intergenic
1094652445 12:32391058-32391080 GAGAGGCGCTGCAAGAGCCAGGG - Intergenic
1101033773 12:100685263-100685285 GAGATGGGCTCCCACAGCCTTGG + Intergenic
1101380690 12:104211657-104211679 GAGATGCCCTCCCCCAGGCATGG + Intergenic
1102386977 12:112518001-112518023 GAGATGAGCTGACCCAAGCATGG - Intergenic
1102822857 12:115923278-115923300 GCCATGCGCTGCCGGAGCCAGGG - Intergenic
1102935230 12:116890968-116890990 GAGTTGCACTGCTCAAGCCAAGG + Intergenic
1104641924 12:130472709-130472731 GAGCTTGGCTTCCCCAGCCAAGG + Intronic
1104820023 12:131671850-131671872 GAGAGGCCCTGCCCCAACCCTGG + Intergenic
1105306327 13:19171652-19171674 AAGATGCGAGGCCCCAGCCAGGG + Intergenic
1105964460 13:25372106-25372128 GCGAGGCGCTGGCCCACCCATGG + Exonic
1108186780 13:47895874-47895896 GCGTTGTGCTGCCACAGCCAGGG + Intergenic
1109996453 13:70133698-70133720 GAGTTGGGCTGCTACAGCCAAGG + Intergenic
1111420153 13:88000569-88000591 CAGCTGCCCTGCCCCTGCCAAGG - Intergenic
1112042198 13:95557752-95557774 GAGATGCCCCGTCCCAGCCCTGG - Intronic
1112071055 13:95850919-95850941 GATATGGGCTGCCCCAGGTAAGG - Intronic
1121286457 14:92739924-92739946 GACAGTCGTTGCCCCAGCCAGGG + Intronic
1122095266 14:99366013-99366035 GAGTTCTGCTGCCACAGCCAAGG - Intergenic
1122864984 14:104599657-104599679 CAGCTGCTCCGCCCCAGCCAAGG + Intronic
1125612524 15:40981339-40981361 TATATGCAATGCCCCAGCCATGG + Intronic
1126185022 15:45823428-45823450 GAGATGGGCTCCCACAGCCTTGG + Intergenic
1126326939 15:47489179-47489201 GAGTGACGCTGCCACAGCCAAGG + Intronic
1127766463 15:62190032-62190054 GATGTGCTGTGCCCCAGCCAGGG - Intergenic
1128907188 15:71477640-71477662 GAGAAGAGCTGACCCAGCTAAGG - Intronic
1129045128 15:72727136-72727158 AAGATGCAAAGCCCCAGCCAGGG - Intronic
1129335937 15:74852262-74852284 GAGAGGCCTTGCCCCAGGCAGGG + Intronic
1129949798 15:79575679-79575701 GAGTTGTTCTGCCCCAGACAAGG - Intergenic
1130957226 15:88636315-88636337 GAGAAGCCCGACCCCAGCCAGGG - Intronic
1132663097 16:1070251-1070273 GGGCTGTGCTGCACCAGCCAGGG + Intergenic
1133287159 16:4695926-4695948 GGGAGGAGCTGCCCCAGCCAGGG + Intergenic
1134834182 16:17347419-17347441 GAGAAGAGATGCCCCAGGCAGGG - Intronic
1135254147 16:20927130-20927152 AAGCTCAGCTGCCCCAGCCATGG - Intergenic
1136055967 16:27689861-27689883 AAGATGGGCTGTCCTAGCCAAGG - Intronic
1136408171 16:30061401-30061423 GGGATGAGCTGCCCCTGCCCTGG + Intronic
1141291817 16:82724873-82724895 GAGAATGGCTGACCCAGCCAAGG - Intronic
1142242312 16:88953167-88953189 GAGAGGCGATGGCCCAGCCCAGG - Intronic
1143417964 17:6763821-6763843 GAGATGCGCTGCCCCAGCCACGG + Intronic
1144946396 17:18971616-18971638 CAGAAACGCTGGCCCAGCCATGG - Exonic
1146523697 17:33547673-33547695 GGGATGAGTTGTCCCAGCCAGGG - Intronic
1146990564 17:37267344-37267366 GAGATGAGTTGTCCCAGCTAAGG - Intronic
1147558699 17:41496054-41496076 CAGATGCCCTGACCCAGGCAGGG + Intergenic
1148634003 17:49133160-49133182 CAGAGGCGCTGACCCAGCCTGGG + Exonic
1149564334 17:57630548-57630570 GGGGTGGGCGGCCCCAGCCATGG - Intronic
1150642653 17:66960102-66960124 GAGAGGCCCTCCACCAGCCAGGG - Intergenic
1151416836 17:73972152-73972174 GAGAGACGCTGTCTCAGCCAGGG + Intergenic
1155213949 18:23625957-23625979 GACCTGCTCTGCACCAGCCATGG + Intronic
1156519522 18:37710167-37710189 AAGTTGCTCTGCCCCAGCAACGG - Intergenic
1161275243 19:3412661-3412683 GAGATTGTCAGCCCCAGCCAAGG + Intronic
1161398671 19:4058310-4058332 GAGCTGTTCAGCCCCAGCCAAGG + Intronic
1161777479 19:6271468-6271490 GAGCTGGGCTGCCCAGGCCACGG - Intronic
1162145469 19:8610532-8610554 GGGATGCCCTCCCCCATCCAGGG + Intronic
1163587041 19:18169683-18169705 GGGCTGCGCGGCCCCAGCCTGGG + Exonic
1164556499 19:29256706-29256728 GAGCTGCTCTGCCCCTCCCAGGG - Intergenic
1166410434 19:42552893-42552915 GCCATGCACTGCCCCAGCCTGGG - Intronic
1168258161 19:55178530-55178552 GAGATTCGATGCCCCAACCCAGG + Intronic
925310832 2:2880477-2880499 CAGATGAGCTGGCCCAGCCCAGG + Intergenic
926085854 2:10020008-10020030 GAGATGCTGTGTCCCAGCAAAGG + Intergenic
926812441 2:16767586-16767608 GAAATGCTTTGCCCCAGCCATGG - Intergenic
927016021 2:18962357-18962379 GCGATGCGCTGCCCCTGCGCCGG - Intergenic
928609983 2:32983127-32983149 GAGATGGGCTCCCACAGCCATGG - Intronic
931164824 2:59734913-59734935 GAAATAGGCAGCCCCAGCCAGGG - Intergenic
931209621 2:60180055-60180077 GAGATTTGCTTCCCCAGCCTGGG - Intergenic
933429178 2:82153038-82153060 GATATGAGCTGCCCCTTCCAAGG + Intergenic
933636179 2:84711258-84711280 GAGAAGGGCTTCCCCAGCAAAGG + Intronic
934054327 2:88239404-88239426 GAGTTGCACTGCCGCAGCCAAGG - Intergenic
937763256 2:125630891-125630913 CAGATGGGGTGCCTCAGCCATGG - Intergenic
944415364 2:199474559-199474581 GAGACTCCCTGCCCCACCCAAGG - Intergenic
945120745 2:206454836-206454858 GGGATGGGCTGCCACAGCCTTGG + Intronic
945947375 2:216007302-216007324 GAGACGCACAGCCCCAGCCGAGG + Intronic
947689300 2:232120105-232120127 GAGGTCCTCTGCCCAAGCCAGGG - Intronic
948426089 2:237887229-237887251 GAGATGCCATGGCCCAGCCTGGG - Intronic
948482193 2:238257216-238257238 CAGATGCTCTGGCCCAGGCATGG + Intronic
948658205 2:239489938-239489960 GAGAAGCACTGCCCCAGGCAGGG - Intergenic
948868708 2:240787759-240787781 GAGATCAGCTGCCCCAGCCAGGG + Intronic
1169822485 20:9727900-9727922 TAGTTTCCCTGCCCCAGCCATGG + Intronic
1172093663 20:32450393-32450415 GACAGGGGCTGCCCCAGGCAAGG + Intronic
1172123203 20:32610547-32610569 CAGATGTTCTGTCCCAGCCACGG - Intergenic
1174682994 20:52426029-52426051 GGCAGGCTCTGCCCCAGCCAGGG - Intergenic
1178670751 21:34589743-34589765 GAGATGAGCTGTCCCAGCTCAGG - Intronic
1178790293 21:35693423-35693445 GAGAGGCTCGGCCACAGCCATGG + Intronic
1179988864 21:44935452-44935474 GTGCTGCTCTGCTCCAGCCATGG - Intronic
1180595029 22:16967503-16967525 GAGGTGCACTTCCCCAGACAAGG + Intronic
1180717617 22:17882433-17882455 GAGATGCGGAGGGCCAGCCATGG + Intronic
1180875210 22:19171919-19171941 GAGAGGCGCTGTGCCCGCCAGGG - Intergenic
1180960724 22:19761143-19761165 CAGCTGCGCGGCCGCAGCCAAGG + Exonic
1181275070 22:21683012-21683034 GAGGTGGTCTGCCCCAGGCAGGG - Intronic
1182081777 22:27534396-27534418 GAGCTGCTCTGCTCCAGCCTAGG - Intergenic
1182697434 22:32206421-32206443 GGGCTGCGCTGCCCAAGGCAGGG + Intergenic
1184067605 22:42129338-42129360 GCAAAGCCCTGCCCCAGCCAAGG - Intronic
1184192690 22:42905500-42905522 GTGATGGGCTGCCCAGGCCAGGG - Intronic
950333875 3:12178286-12178308 GAGACCAGCTGCCCCAACCAAGG - Intronic
951520197 3:23604293-23604315 GAGTTGTGCTGCCACAGCCTAGG + Intergenic
952899142 3:38098060-38098082 GAGCTGAGCTGCCTCAGCGATGG - Intronic
954428743 3:50458019-50458041 GTAATGCCCTCCCCCAGCCATGG + Intronic
954518071 3:51197864-51197886 GAGGTGGGCTACCCCTGCCAGGG - Intronic
954857638 3:53660359-53660381 GAGTTGCTCTGTGCCAGCCAGGG + Intronic
955067244 3:55544039-55544061 ATGCTGCCCTGCCCCAGCCATGG - Intronic
958128435 3:89386784-89386806 GAGATGGGCTCCCACAGCCTTGG - Intronic
958463315 3:94426681-94426703 GAGATGGGCTCCCACAGCCTTGG - Intergenic
959107847 3:102085560-102085582 GTGATGCATTGCCCAAGCCAGGG - Intergenic
959754662 3:109883430-109883452 GAGATGGGCTCCCACAGCCTTGG + Intergenic
961986300 3:131138436-131138458 GAGATGCTCTCCCAGAGCCAGGG - Intronic
964966117 3:162495793-162495815 GAGATGGGCTCCCACAGCCTTGG + Intergenic
965519319 3:169657690-169657712 CAAATAAGCTGCCCCAGCCAGGG + Intronic
971884359 4:32423999-32424021 GTGTTACGCTGCCCCATCCAGGG - Intergenic
972530017 4:39953284-39953306 GAGATCAGTTACCCCAGCCACGG - Intronic
974779199 4:66529241-66529263 GAGATGGGCTCCCACAGCCTTGG - Intergenic
975087208 4:70356293-70356315 CAGGTGAGCTGTCCCAGCCAAGG + Intergenic
975494987 4:75027374-75027396 GAGATGTGCTTCCCCTGGCATGG + Intronic
981242453 4:142493481-142493503 GAGATGGGCTCCCACAGCCTTGG - Intronic
984655363 4:182311561-182311583 GAGATTCACTGGCCCATCCAAGG - Intronic
984912430 4:184686880-184686902 GAGATACAGTGCCACAGCCAGGG + Intronic
996513446 5:124343495-124343517 TGCATGCGCTGCGCCAGCCAGGG - Intergenic
997698997 5:135883220-135883242 AAGCTCCGCTGCCCCAGCCGGGG - Intronic
997979803 5:138461876-138461898 AACATCCTCTGCCCCAGCCAGGG - Intergenic
999263415 5:150251511-150251533 GAGAGGCGCCTCCCAAGCCAGGG - Intronic
1000936528 5:167308530-167308552 GAGATGTGCTGTCTCAGCCCAGG + Intronic
1001530153 5:172455621-172455643 ACGAGGAGCTGCCCCAGCCACGG - Intergenic
1002763490 6:219379-219401 GAGATCCGGTGCCCCTGCCTGGG - Intergenic
1002836566 6:869558-869580 GAGATGCTCTGCACCAACCTGGG - Intergenic
1004288282 6:14343138-14343160 GAGTTATGCTGCCACAGCCAAGG + Intergenic
1007234112 6:40378237-40378259 CAGAGGCCCTGCCCCACCCAGGG - Intergenic
1013663609 6:112323778-112323800 GAGATGAGCTGGGCCAGGCATGG - Intergenic
1013947290 6:115736332-115736354 GAGATGCGCTCCAACAGCCCTGG - Intergenic
1014001530 6:116370958-116370980 GGGATGCGCTGCTGCAGCCTCGG - Exonic
1014913066 6:127117356-127117378 AAGATGCTCTGGCCCACCCAGGG - Intergenic
1016616279 6:146052389-146052411 TAGATGCCCAGCCCCAGCCGTGG + Intronic
1016682279 6:146844927-146844949 GAGATGGGCTCCCACAGCCTTGG + Intergenic
1018093655 6:160366389-160366411 GAGATGGGCTCCCACAGCCTTGG + Intronic
1018370754 6:163165649-163165671 GAGAGGCGCTGGCCCAGCGTGGG + Intronic
1019301702 7:307638-307660 GAGCTGCTCGGCCTCAGCCAAGG - Intergenic
1020693892 7:11391835-11391857 GGGATTCCCTGCCCTAGCCAAGG - Intronic
1024127988 7:46320402-46320424 GAGCTGTGCTGCCCAAGTCAAGG + Intergenic
1024262817 7:47584390-47584412 GAGCTTCGCTTCCCCAGCCCAGG + Intergenic
1025014490 7:55427933-55427955 GAGAGGCGGCGCCCCAGGCAGGG + Intronic
1025861870 7:65337936-65337958 GAGATGGGCTCCCACAGCCTTGG - Intergenic
1025997466 7:66537096-66537118 GAGCTGCCCTGCCCCACCCGAGG + Intergenic
1030201612 7:106911413-106911435 GAGAAGAGCTGCACGAGCCAAGG - Intergenic
1033313732 7:140281136-140281158 TGGATGTGCTCCCCCAGCCAAGG - Intergenic
1034275995 7:149824102-149824124 GAGCTGCACTGCACCAGCCAGGG + Intergenic
1035285656 7:157804993-157805015 GGGATGCGCTGCCTCAGCGTGGG + Intronic
1035579157 8:729125-729147 CTGATTCGCTGCCGCAGCCAGGG + Intronic
1037402678 8:18508678-18508700 CAGATGAGCTGTCCCTGCCAGGG + Intergenic
1038281748 8:26171435-26171457 GAGATGCAGTGCGCCAGCCTGGG + Intergenic
1039212827 8:35235839-35235861 CAGAAGCACAGCCCCAGCCACGG - Exonic
1040899391 8:52402832-52402854 GAGCTGTGCTGCCCCACCCCTGG - Intronic
1044461659 8:92452353-92452375 CAGCTGCCCTGCCCCAGCCTGGG + Intergenic
1045139894 8:99268444-99268466 GAGATGGGCTCCCACAGCCTTGG - Intronic
1046279170 8:112002856-112002878 GAGATGCGCTTCACCAGAGAGGG - Intergenic
1047727135 8:127693834-127693856 GAGATGGGCTGTCTCATCCATGG - Intergenic
1049258115 8:141624684-141624706 GTGTTTCGCTGCCCCTGCCAGGG - Intergenic
1049830507 8:144698768-144698790 GAGATGCCCTGACCCACTCATGG - Intergenic
1052815942 9:33102656-33102678 GAGGTTCCTTGCCCCAGCCAGGG - Intergenic
1053511316 9:38690024-38690046 GAAATGCGCTTGCCCAGCCCAGG - Intergenic
1054721496 9:68608901-68608923 GGGATGCGCTGCTGCAGCCTCGG - Intergenic
1055921506 9:81466054-81466076 GACATGGGCTGCCCCAGGAATGG - Intergenic
1055951549 9:81734230-81734252 GAGATGGGGTCCCCCAACCAAGG - Intergenic
1056433113 9:86548212-86548234 GATATGGGCTGCCCCAGGAAGGG + Intergenic
1057199039 9:93130665-93130687 GCCATGCGCTCCACCAGCCACGG - Intronic
1057267882 9:93630899-93630921 GTGATCAGCTGACCCAGCCAGGG - Intronic
1059335253 9:113564992-113565014 GCTTTGCGCTGCCCCAGCCTGGG + Intronic
1060731499 9:126039714-126039736 CAGGTGAGCTGCCCCAGCCCGGG - Intergenic
1061193236 9:129094280-129094302 AGGATGCCCTGCCTCAGCCATGG + Intergenic
1061572096 9:131484232-131484254 GAGATGCCCTGGGCCAGACAGGG - Intronic
1061883058 9:133577621-133577643 GAGAGGGGCTGCCCCGGCCCTGG + Intergenic
1062126829 9:134868509-134868531 GGGATGCGCTCCTCCAGCCAGGG - Intergenic
1062598982 9:137311677-137311699 GGGAGGCCCTGCCCCGGCCAGGG + Intronic
1188719550 X:33505949-33505971 GAGATGGGCTCCCACAGCCTCGG - Intergenic
1189239034 X:39511564-39511586 GACATGAGCTGCCCCAGGAAGGG + Intergenic
1190514363 X:51207382-51207404 GAGGTGGGCTGCCACAGCCTTGG - Intergenic
1191128710 X:56985402-56985424 GATATGGGCTGCCCCAGGAAGGG - Intronic
1193880401 X:86914007-86914029 GATATGAGTTGCCCCAGGCAGGG - Intergenic
1194756369 X:97743705-97743727 GAGATGGGCTCCCACAGCCTTGG - Intergenic
1195608293 X:106834835-106834857 GAGGTGGGCTGCCACAGCCTTGG + Intronic
1195934295 X:110110466-110110488 CTGATGCGCTGCCCCACCCTTGG + Intronic
1198612574 X:138418270-138418292 GAGATGGGCTCCCACAGCCTTGG - Intergenic
1200316308 X:155136782-155136804 GAGATGCCCTGCCCCAAACCTGG + Intronic
1200380785 X:155834949-155834971 GAGATGGGCTCCCACAGCCTTGG - Intergenic
1202191063 Y:22245385-22245407 GAGAGGAGCTGCCCCCTCCAGGG + Intergenic