ID: 1143420667

View in Genome Browser
Species Human (GRCh38)
Location 17:6789202-6789224
Sequence ATGTGAATGGCCAAGTTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 154}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143420665_1143420667 1 Left 1143420665 17:6789178-6789200 CCGGGTCTGTGATGTTGAACATA 0: 1
1: 0
2: 0
3: 19
4: 184
Right 1143420667 17:6789202-6789224 ATGTGAATGGCCAAGTTTGATGG 0: 1
1: 0
2: 0
3: 8
4: 154
1143420664_1143420667 18 Left 1143420664 17:6789161-6789183 CCACAAATATGCTGAGACCGGGT 0: 1
1: 0
2: 1
3: 5
4: 53
Right 1143420667 17:6789202-6789224 ATGTGAATGGCCAAGTTTGATGG 0: 1
1: 0
2: 0
3: 8
4: 154
1143420661_1143420667 29 Left 1143420661 17:6789150-6789172 CCTTTATTTTTCCACAAATATGC 0: 1
1: 0
2: 7
3: 33
4: 426
Right 1143420667 17:6789202-6789224 ATGTGAATGGCCAAGTTTGATGG 0: 1
1: 0
2: 0
3: 8
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143420667 Original CRISPR ATGTGAATGGCCAAGTTTGA TGG Intronic
904840963 1:33371510-33371532 ATGGCAGTGGCCAAGTGTGATGG - Intronic
904995450 1:34627990-34628012 ATGGTAATTGCCACGTTTGAGGG + Intergenic
906491270 1:46270684-46270706 TTTTGAATTGCCAATTTTGAAGG + Exonic
908169720 1:61492555-61492577 ATGTGGAAGGCCAAGTGTGGTGG - Intergenic
908307544 1:62838488-62838510 ATATGAATGGCCAGGCATGATGG + Intronic
909935112 1:81542180-81542202 TTGTGAATGTGCAAGTCTGATGG - Intronic
910292120 1:85609391-85609413 ATGTGAGATGCCAAGTTGGAAGG - Intergenic
910400177 1:86830632-86830654 ATGTGATTGGCCAAGTGCAATGG + Intergenic
916429786 1:164716565-164716587 CTGTGAAAGGCCAAGTGTGGTGG + Intronic
916795526 1:168163563-168163585 ATGTGAAAGGCCAAGAAAGAAGG - Intergenic
917619227 1:176778946-176778968 ATGTGAATGGCTAAGTCTTGGGG - Intronic
918276886 1:182961399-182961421 ATGTGAATGTACAAGTTTTGGGG - Intergenic
920164572 1:204026481-204026503 ATGTGAATGGCCAGGGAAGAGGG + Intergenic
920452559 1:206070821-206070843 AAGTGAAGGGCCAAGACTGACGG - Intronic
922070018 1:222183092-222183114 ATGTGAATGGCCATGGTTATTGG - Intergenic
922216246 1:223522483-223522505 ATGTGAAGAGCCCAGTTTAACGG - Intergenic
923552801 1:234977652-234977674 CTGTGCCTGGCCAAGTGTGAGGG - Intergenic
923905908 1:238383405-238383427 ATGTGAATGGGCTAATTTGAGGG + Intergenic
1064843911 10:19629571-19629593 ATGTGCACGGCCAAGCTTCATGG + Intronic
1068645518 10:59462478-59462500 ATGTGCATGGCAGAGTCTGAAGG + Intergenic
1069740797 10:70685948-70685970 ATGTCAATGGCCCAGTTAGTGGG + Intronic
1072941786 10:99771301-99771323 ATGAGAATGGCCAAATTAGTGGG - Intergenic
1073625586 10:105092586-105092608 TTGTGAATGCACAAGTGTGAGGG - Intronic
1073653228 10:105383729-105383751 CTGGGCATTGCCAAGTTTGACGG + Intergenic
1074625124 10:115175104-115175126 ATTTTAATGGCCAACATTGAAGG - Intronic
1076602486 10:131667803-131667825 ATGTGAAAAGCAAAGTTGGAGGG - Intergenic
1078930351 11:15907680-15907702 GTGTGTAGGGCCAAGTGTGATGG - Intergenic
1079026318 11:16950694-16950716 ATGTGAATGGCTCAGGCTGAGGG - Intronic
1080590582 11:33719958-33719980 TTGAGACTGGCCATGTTTGAGGG + Intronic
1084875431 11:72128872-72128894 ATGTGAATGGCCCAGCCTTAAGG - Intronic
1085287018 11:75369597-75369619 ACGTGACTGGCCAAGTGTGGTGG - Intergenic
1086959243 11:92965745-92965767 AAGTGAATTGCCAAGGTTGGTGG - Intergenic
1090357973 11:126153319-126153341 ATGTGAATGGCTAAATAAGAAGG - Intergenic
1090519138 11:127459970-127459992 ATGTTTTTGGCCTAGTTTGAGGG - Intergenic
1094457756 12:30657486-30657508 ATTTGTATGGGTAAGTTTGAAGG - Intronic
1095240608 12:39854484-39854506 ATGTTAAAGGCAAAGTATGAGGG - Intronic
1098813197 12:75122262-75122284 ATTTGAATGGCCAATTTTGGAGG - Intronic
1099950084 12:89292135-89292157 ATGTCAATGGCAAATTTTCATGG + Intergenic
1102746657 12:115255031-115255053 TTGTGAATGGACAAGTCAGAGGG - Intergenic
1103371740 12:120424534-120424556 ATGTGACTGGCCAGGTGTGGTGG - Intergenic
1103488745 12:121299943-121299965 ATGTGAAAGGCCAGGTGTGGTGG + Intergenic
1106295989 13:28414055-28414077 ATGTCATTGGCCAACATTGAGGG + Intronic
1106327263 13:28705310-28705332 AAGGAAATGGCCAAGCTTGAGGG + Intronic
1108430677 13:50350559-50350581 ATTGGAATGGCCAAAATTGAAGG - Intronic
1111245752 13:85537840-85537862 ATGAGAATGGCCTAGTTTCCAGG - Intergenic
1113673650 13:112193832-112193854 TACTGAATGGCCGAGTTTGAGGG - Intergenic
1117036271 14:51732943-51732965 ATATGACTGGCTAAGTATGAGGG + Intergenic
1128513140 15:68325967-68325989 AAGTGAATTTCCAAGTTTGTGGG + Intronic
1129498127 15:76006737-76006759 TAGAGAATGGCCAAGTTTGCTGG - Intronic
1129669001 15:77596732-77596754 ATGACAATGGCCATTTTTGAGGG - Intergenic
1135525642 16:23211920-23211942 ATGTGGTTGGCCAAGGTTAAGGG + Intronic
1135723519 16:24836802-24836824 ATGGGAATGGGAGAGTTTGAAGG + Intergenic
1137439463 16:48485701-48485723 CTGTGACTGGCCAGATTTGAGGG - Intergenic
1139090325 16:63638518-63638540 ATGGAACTGGCCAAGTTAGAAGG - Intergenic
1139108489 16:63858923-63858945 ATGTGAAAGGCCTATTTTGGGGG + Intergenic
1139520213 16:67478323-67478345 GTGTGAATGGCCAAGCGTGGTGG + Intronic
1140163120 16:72519994-72520016 ATGTTAGGGGCCAAGTTTGGAGG + Intergenic
1140842312 16:78851147-78851169 TTCTGAATGAGCAAGTTTGAGGG - Intronic
1143420667 17:6789202-6789224 ATGTGAATGGCCAAGTTTGATGG + Intronic
1143992703 17:10980114-10980136 AGGTGAAGAGCCAGGTTTGATGG + Intergenic
1144112799 17:12053308-12053330 ATGAAAATGGCAAAGTTTGAAGG - Intronic
1146675536 17:34771325-34771347 ATGTAAATGCTCAGGTTTGATGG + Intergenic
1146991104 17:37273491-37273513 ATGTGATTGGTCAACTTGGAAGG + Intronic
1152170810 17:78746652-78746674 ATTTGAAAGGCCAGGTGTGATGG + Intronic
1153276243 18:3370609-3370631 TGATAAATGGCCAAGTTTGAAGG - Intergenic
1153433126 18:5040198-5040220 ATTTGACTGAGCAAGTTTGAAGG + Intergenic
1156089272 18:33445338-33445360 ATGTGCATGGGCTAGTGTGAGGG + Intergenic
1159293268 18:66449709-66449731 ATGTGAATTGCCTAATTTGGAGG + Intergenic
1160042916 18:75361644-75361666 GTGTGAATGGCTGAGTGTGAGGG + Intergenic
1164565270 19:29321474-29321496 ATGTGATTGGAGAATTTTGAAGG + Intergenic
1165539755 19:36482755-36482777 AAGGAAATGGCCAAATTTGATGG + Intronic
926604228 2:14880840-14880862 CTCTGAATGGTCAACTTTGAAGG + Intergenic
927335251 2:21915083-21915105 ATGCCAATGGCCAAGTTCCAGGG - Intergenic
930923552 2:56788338-56788360 GAGTGAATGGCCAAATTTTAGGG - Intergenic
931999053 2:67866978-67867000 ATGTTTCTGGCCAAGTGTGATGG + Intergenic
936685396 2:114821332-114821354 GTGAGAATTGCCATGTTTGATGG + Intronic
940761868 2:157747602-157747624 ATGTGAATGTTAAAATTTGAAGG + Intronic
942576165 2:177365536-177365558 AAATGAATGACCAAGTTTTATGG - Intronic
943516984 2:188900837-188900859 AGCTGAATGGCCAAGGGTGAGGG - Intergenic
944880919 2:204012284-204012306 TTGTGACTGGCCAAGATTGCTGG + Intergenic
945777738 2:214128251-214128273 ATGTGAATTGCCCAGTTGGGTGG + Intronic
1170586112 20:17735388-17735410 ATGTGCTTGTCAAAGTTTGAAGG + Intronic
1172115693 20:32572264-32572286 ATGTGATTGTCCAAATTTGGTGG - Intronic
1173448780 20:43143805-43143827 AGTTGAATGGCCATTTTTGATGG - Intronic
1173973348 20:47169176-47169198 ATGACAATGGCCAAGATTTAAGG + Exonic
1182840324 22:33384171-33384193 AGGTGAGTGGCCAGGTTCGAAGG - Exonic
1183126412 22:35785942-35785964 ATGTTAAGAGGCAAGTTTGAAGG - Intronic
1183810150 22:40249276-40249298 AAGTGAATGGTCAAGAATGAAGG + Intronic
953040674 3:39252619-39252641 AAGAGAAGGGCCAAGTTTCATGG - Intergenic
953421098 3:42753905-42753927 ATGTGAATGGGGAAGTTGTATGG + Intronic
953601650 3:44371721-44371743 ATGAGCATTGCCCAGTTTGAAGG + Intronic
960128392 3:114025813-114025835 ATGTGTGTGGCCAAGGATGAAGG - Intronic
962714200 3:138113312-138113334 AGGTGTTTGGCCAATTTTGAGGG - Intronic
963009225 3:140753691-140753713 ATGTAGATGGCCAAGTGAGAGGG - Intergenic
964559471 3:157977771-157977793 ATGTGTGTGGACAATTTTGATGG - Intergenic
972865682 4:43229029-43229051 ATCTTAATGGCCAAGACTGAAGG + Intergenic
973065044 4:45779618-45779640 ATTTAAATAGCCAAGTTTCATGG - Intergenic
973897757 4:55432598-55432620 ATTTGAATGCTCAAGTTTCATGG + Exonic
975371557 4:73594511-73594533 ATGAGAAAGCCCAAGTTTAAAGG - Intronic
976872308 4:89810248-89810270 ATGAGAAAGGCAAAGTTTTAAGG + Intronic
978501591 4:109415859-109415881 ATATGTATGGCCAAGTGTGGTGG - Intergenic
978878892 4:113676310-113676332 AGGAGGATGGCCAAGTTTCAAGG - Intronic
979696192 4:123616009-123616031 CTGTGAATGGGTAGGTTTGAAGG - Intergenic
979970680 4:127130835-127130857 ATGTGAATGGCCGAGCCTGCAGG + Intergenic
981581806 4:146256850-146256872 ATTTTAATGCCCAAATTTGATGG + Intronic
983415035 4:167441406-167441428 ATGTGAATGGATAAAATTGAGGG + Intergenic
986294284 5:6424246-6424268 ATGTGAGTGGCCCAGGTGGATGG - Intergenic
987035472 5:14014454-14014476 ATGATAATGGCCAAGTTTAGAGG - Intergenic
991715911 5:69450911-69450933 ATTTGAATGGCCATTTTTCAAGG - Intergenic
992412922 5:76524712-76524734 ATGTGAATGCCCTAGTTATAAGG - Intronic
994953511 5:106497318-106497340 TTGTGTATGGTCAAGATTGATGG - Intergenic
996543379 5:124652670-124652692 TTGTGAAGGGCCAAGTATAAAGG + Intronic
998302334 5:141035879-141035901 ATATGAATTGCTAAGATTGATGG - Intergenic
1001046031 5:168372456-168372478 ATGTGCCTGGCAAAGTCTGAAGG + Intronic
1001602273 5:172936698-172936720 ATGTGAAAAGCCAAGTAGGACGG + Intronic
1002308291 5:178297122-178297144 ATGTGAATGTCTAAGGCTGAAGG - Intronic
1007559464 6:42794607-42794629 ATTTGAATTGTCAAGTTTTAAGG + Intronic
1011227128 6:85119828-85119850 ATGTGAAAGGGAATGTTTGAGGG - Intergenic
1016688627 6:146910098-146910120 ATTTAAATGGCCAAGTGTGATGG + Intergenic
1017117522 6:150992672-150992694 ATGTCAATGGCCATGTTTAGTGG + Intronic
1018590386 6:165413767-165413789 ATGTAAATTGCAAAGATTGAGGG - Intronic
1020482928 7:8684339-8684361 ATATCAAAGGCCAAGTTTCAAGG - Intronic
1021381284 7:19969840-19969862 TGGGGAATGGACAAGTTTGAGGG - Intergenic
1021845769 7:24761210-24761232 AGGTGAATGGCCTGGTTTGGAGG + Intergenic
1021922865 7:25504338-25504360 ATGTGAATGTCCATTTTTGTTGG + Intergenic
1022839837 7:34153211-34153233 TTGTGAAGGACCAAGTTTGCTGG - Exonic
1022867738 7:34439698-34439720 ATTTGAATGGCCAGGTGTGGTGG + Intergenic
1023517549 7:41017219-41017241 ATGAGAATGTCAAAGTTTTAGGG - Intergenic
1024615869 7:51111358-51111380 ATGTAAAAGGCCAAGTTAGAAGG - Intronic
1024946333 7:54811291-54811313 ATGTGAAAAGCCATATTTGATGG - Intergenic
1027225992 7:76243979-76244001 AGGTGAATGCCCGAGTCTGAGGG + Intronic
1031871693 7:127094887-127094909 ATGTGAATTCCCAAGTATAAAGG - Intronic
1032132738 7:129244245-129244267 TTTTGAAAGGCCAAGGTTGAAGG - Intronic
1033761640 7:144442330-144442352 AAGTGGATGGCCAGCTTTGATGG + Intergenic
1034402136 7:150869459-150869481 ATGTCAATAGCTGAGTTTGATGG + Intergenic
1038333330 8:26627040-26627062 ATGTTACTGGCCACATTTGATGG - Intronic
1038654056 8:29432450-29432472 ATTTGAATAGCAAAGTTTGATGG + Intergenic
1039179689 8:34851914-34851936 ATGTCAATGGCCAAGCTAGAAGG + Intergenic
1040595643 8:48835121-48835143 ATGTTAATGCCCATGTGTGAGGG - Intergenic
1041594129 8:59626440-59626462 ATCTGAATTTCCAAGTTTTATGG - Intergenic
1042254492 8:66789242-66789264 AGGTAAATGGCCAAGTTAAATGG + Intronic
1043262862 8:78223715-78223737 ATGTGATTGCCCATGTTAGAGGG + Intergenic
1043709587 8:83398917-83398939 ATGTGAATGACTAAGCTGGATGG - Intergenic
1044301910 8:90594250-90594272 ATCAGAAAGGCCAAGTGTGAAGG + Intergenic
1044857281 8:96489683-96489705 ACATGAAGGGCCAAGTGTGATGG + Intergenic
1045312555 8:101015743-101015765 ATATGAAATGCCAAGTCTGATGG - Intergenic
1049991035 9:991859-991881 ATATGAATGGCAAAGTTTTAGGG + Intergenic
1050739227 9:8801424-8801446 CTGTGCTTGGCCAGGTTTGATGG - Intronic
1050971863 9:11888102-11888124 ATGAGCATAGCCAAGGTTGAAGG + Intergenic
1058661108 9:107269983-107270005 ATGAGAATGGCTTAGTTTTAGGG + Intergenic
1187936449 X:24340914-24340936 ATGGGAATGGACAAGTCTGGGGG + Intergenic
1188506017 X:30885774-30885796 ATGAGAATAGCCAAGAGTGAGGG - Intronic
1188557060 X:31424374-31424396 CTGTGATTGGACAAGGTTGAGGG + Intronic
1193140414 X:78020806-78020828 ATGTTAATGGCCAGGTGTGGTGG - Intronic
1193869306 X:86777377-86777399 ATGTGCAGGGACAAGTGTGAAGG - Intronic
1194578654 X:95643651-95643673 ATGTGAAAGTCCATGTTTAAAGG + Intergenic
1195380596 X:104267371-104267393 ATGGGAAGGACCAAGTTTTAGGG + Intergenic
1197930865 X:131695050-131695072 GTGTAAATGGAAAAGTTTGAAGG - Intergenic
1199338716 X:146650282-146650304 ATGTCAATGTCAAAATTTGAGGG - Intergenic
1199733790 X:150664979-150665001 GTGTGACAGGTCAAGTTTGAGGG + Intronic
1201772993 Y:17636370-17636392 TTTTAAATGGCCAAGTTTAATGG - Intergenic
1201828562 Y:18269616-18269638 TTTTAAATGGCCAAGTTTAATGG + Intergenic
1202594370 Y:26521311-26521333 TTGTGTATGCCCAAGTCTGAGGG + Intergenic