ID: 1143423312

View in Genome Browser
Species Human (GRCh38)
Location 17:6813040-6813062
Sequence CTGTTTCAGCTCCGTGAGTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 101}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143423312_1143423315 8 Left 1143423312 17:6813040-6813062 CCAGACTCACGGAGCTGAAACAG 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1143423315 17:6813071-6813093 CTTTCATTCACAGCATATTTGGG 0: 1
1: 0
2: 3
3: 22
4: 241
1143423312_1143423322 20 Left 1143423312 17:6813040-6813062 CCAGACTCACGGAGCTGAAACAG 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1143423322 17:6813083-6813105 GCATATTTGGGGTGGGGAAGGGG 0: 1
1: 0
2: 6
3: 49
4: 477
1143423312_1143423324 25 Left 1143423312 17:6813040-6813062 CCAGACTCACGGAGCTGAAACAG 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1143423324 17:6813088-6813110 TTTGGGGTGGGGAAGGGGGTTGG 0: 1
1: 3
2: 42
3: 570
4: 2707
1143423312_1143423319 14 Left 1143423312 17:6813040-6813062 CCAGACTCACGGAGCTGAAACAG 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1143423319 17:6813077-6813099 TTCACAGCATATTTGGGGTGGGG 0: 1
1: 0
2: 3
3: 19
4: 226
1143423312_1143423314 7 Left 1143423312 17:6813040-6813062 CCAGACTCACGGAGCTGAAACAG 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1143423314 17:6813070-6813092 GCTTTCATTCACAGCATATTTGG 0: 1
1: 0
2: 1
3: 10
4: 240
1143423312_1143423320 18 Left 1143423312 17:6813040-6813062 CCAGACTCACGGAGCTGAAACAG 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1143423320 17:6813081-6813103 CAGCATATTTGGGGTGGGGAAGG 0: 1
1: 1
2: 11
3: 55
4: 442
1143423312_1143423317 12 Left 1143423312 17:6813040-6813062 CCAGACTCACGGAGCTGAAACAG 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1143423317 17:6813075-6813097 CATTCACAGCATATTTGGGGTGG 0: 1
1: 0
2: 0
3: 11
4: 143
1143423312_1143423318 13 Left 1143423312 17:6813040-6813062 CCAGACTCACGGAGCTGAAACAG 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1143423318 17:6813076-6813098 ATTCACAGCATATTTGGGGTGGG 0: 1
1: 0
2: 1
3: 14
4: 222
1143423312_1143423321 19 Left 1143423312 17:6813040-6813062 CCAGACTCACGGAGCTGAAACAG 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1143423321 17:6813082-6813104 AGCATATTTGGGGTGGGGAAGGG 0: 1
1: 0
2: 6
3: 38
4: 404
1143423312_1143423316 9 Left 1143423312 17:6813040-6813062 CCAGACTCACGGAGCTGAAACAG 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1143423316 17:6813072-6813094 TTTCATTCACAGCATATTTGGGG 0: 1
1: 0
2: 1
3: 22
4: 289
1143423312_1143423325 26 Left 1143423312 17:6813040-6813062 CCAGACTCACGGAGCTGAAACAG 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1143423325 17:6813089-6813111 TTGGGGTGGGGAAGGGGGTTGGG 0: 1
1: 2
2: 16
3: 232
4: 2260
1143423312_1143423323 21 Left 1143423312 17:6813040-6813062 CCAGACTCACGGAGCTGAAACAG 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1143423323 17:6813084-6813106 CATATTTGGGGTGGGGAAGGGGG 0: 1
1: 1
2: 9
3: 58
4: 680

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143423312 Original CRISPR CTGTTTCAGCTCCGTGAGTC TGG (reversed) Exonic
900366033 1:2312387-2312409 CTGGTTCAGCCCCGCGTGTCCGG + Intergenic
901795603 1:11677588-11677610 CTGATTCAGCTCCGGGTGGCAGG + Exonic
905556366 1:38888318-38888340 GTTTGTCAGCTCCATGAGTCAGG - Intronic
906256796 1:44356471-44356493 CTGTTCCAGCTCCAAGAGTTGGG - Intergenic
915894750 1:159803071-159803093 CTGTTTCAGATCCATGGGGCTGG + Intronic
924237633 1:242012518-242012540 ATGTCTCAGCTCCCTGATTCTGG + Intergenic
1066252133 10:33644521-33644543 TTGTTCCAGCTCAGTCAGTCAGG - Intergenic
1066482419 10:35809862-35809884 CTGCGTCAGCCCCGGGAGTCAGG + Intergenic
1067421589 10:46156239-46156261 CTGTTTCAGCTAAGATAGTCAGG + Intergenic
1067458506 10:46440515-46440537 CTGTTTCAGCTACTTGATCCTGG + Intergenic
1067506894 10:46862331-46862353 CTGTTTCAGCTAAGATAGTCAGG + Intergenic
1067628692 10:47944120-47944142 CTGTTTCAGCTACTTGATCCTGG - Intergenic
1067761750 10:49053701-49053723 TTGTTTCAGCCCAGTGAGTAGGG + Intronic
1070859072 10:79635385-79635407 CTGTTTCAGCTAAGATAGTCAGG + Intergenic
1073647067 10:105316107-105316129 CTGTTTCAGTTCCGACAGTGAGG - Intergenic
1073664232 10:105511704-105511726 CTGTTTCTGCTCTGTGATTTTGG + Intergenic
1075626654 10:123968832-123968854 CTCTTTTAGCTGGGTGAGTCTGG - Intergenic
1076716793 10:132370038-132370060 TTGTGGCACCTCCGTGAGTCTGG - Intronic
1077068208 11:654279-654301 CTGTCTCAGCCTCCTGAGTCTGG + Intronic
1081899841 11:46618115-46618137 CTTTTTCAGCTCCTTGGGTTAGG + Intronic
1085269536 11:75262189-75262211 TGGTTTCAGCTCCCTGAGCCTGG + Intergenic
1088084491 11:105960600-105960622 CTGTTTCAGCTCCTTGGGGGAGG - Intronic
1088920403 11:114256788-114256810 CTGTCTCATCTCCCTGTGTCTGG + Intergenic
1088949068 11:114547046-114547068 CTGTTCCATCTCCTTGAGTGGGG - Intronic
1092169244 12:6363110-6363132 CTGTTTCTGGTCCTTGATTCAGG - Intronic
1092598903 12:10037405-10037427 TTATTTCAGCTCCGTGTCTCAGG + Intronic
1095386909 12:41661320-41661342 CTGGATCAGCACCCTGAGTCAGG + Intergenic
1095962933 12:47846605-47846627 CTTTTTCAGCTCCCAGATTCTGG - Intronic
1096778796 12:53980091-53980113 ATGTTTCAGCTCCGGAGGTCAGG + Intergenic
1099813954 12:87621392-87621414 ATGTTTCAGCTCAGGGAGTTTGG - Intergenic
1100857470 12:98770727-98770749 CAGCTTAAGGTCCGTGAGTCAGG - Intronic
1103905859 12:124326916-124326938 CTGTCTCAGCCCTGGGAGTCAGG - Intronic
1104628107 12:130376559-130376581 CTGTTCCAGCTCCGTAAATCAGG + Intergenic
1104779877 12:131413262-131413284 CTGTGGCAGCTCCATGAGGCGGG - Intergenic
1107962169 13:45568173-45568195 CTGTTCCTGCTCCTTGACTCAGG + Intronic
1111092156 13:83461976-83461998 CTGTTTGAGCTCCTTGGGTAGGG + Intergenic
1111559228 13:89923333-89923355 ATGTTCCAGCTCAGTCAGTCAGG - Intergenic
1114976386 14:28105767-28105789 CTGTTTCACCTCTGTGTGTTGGG + Intergenic
1115157575 14:30358305-30358327 CTGTTTCATCCCCTTGAATCTGG + Intergenic
1120831565 14:89001734-89001756 CTTTTTCAGCTCTGTGACTCTGG + Intergenic
1132516095 16:366701-366723 CTGGTGCAGCTGCCTGAGTCAGG - Intergenic
1132637517 16:959578-959600 CTGTTTCACATCCGTGCGTGTGG - Intronic
1132806004 16:1775417-1775439 CTGTCTGAGCTGGGTGAGTCAGG + Intronic
1133406984 16:5532434-5532456 CAGGTTCAGATCAGTGAGTCCGG - Intergenic
1134853081 16:17497952-17497974 CTGTTTCTGCTCCTTGATTCTGG + Intergenic
1139398096 16:66656936-66656958 CTCTTTAATCTCCTTGAGTCTGG - Intronic
1141414067 16:83856466-83856488 CTGTCACAGCTCTGTGAGTGTGG - Intergenic
1142232525 16:88906460-88906482 CTTATTCACCTCCGTGTGTCTGG - Intronic
1143423312 17:6813040-6813062 CTGTTTCAGCTCCGTGAGTCTGG - Exonic
1148440056 17:47707365-47707387 CTGTTCCAGCTCCATGAGGGTGG + Intronic
1149229735 17:54519105-54519127 CTGTTTGAGCTCCTTGGGTGAGG - Intergenic
1149310911 17:55392227-55392249 CTGTTCCAGCTCCCTGATTTAGG + Intergenic
1149907085 17:60536316-60536338 TTGTTTCAGCTCCATGATGCTGG - Intergenic
1152396166 17:80035296-80035318 CTGTTTAAGATCCGCGTGTCGGG - Intronic
1153872970 18:9337290-9337312 TTGTTACAGCTCAGTGATTCTGG - Exonic
1155109834 18:22703280-22703302 CTGTTTCAGCTCTAGGAATCTGG - Intergenic
1160932607 19:1577826-1577848 CTGTCCCAGCTCCTTGAGACTGG - Exonic
1160968549 19:1757361-1757383 CAGTCTCAGCTCTGGGAGTCTGG + Intronic
1161528072 19:4769682-4769704 CTGTTTCAGCACCGGGGCTCAGG + Intergenic
1163949700 19:20572122-20572144 CTGTTTGAGCTCCTTGAGGGAGG - Intronic
1163968380 19:20769781-20769803 CTGTTTGAGCTCCTTGAGGGAGG + Intronic
1164574277 19:29396597-29396619 GAGGTTCAGGTCCGTGAGTCTGG + Intergenic
1165147483 19:33740623-33740645 CTGTTTCAGCTCTCTGTTTCAGG + Intronic
1166537895 19:43586710-43586732 ATGTTTGAGCTCCATGTGTCAGG + Exonic
1167469497 19:49667470-49667492 CTGTTTTAGTTGCGTGACTCTGG + Intronic
925072862 2:984698-984720 CTGCCTTAGCTCCGTGACTCAGG + Intronic
927468037 2:23351489-23351511 CTGTTCCAGCCGCGTGGGTCTGG - Intergenic
927881704 2:26693683-26693705 GTGTTTCAGCTCCAGGAGTTTGG + Intronic
929360314 2:41080889-41080911 ATGTGTCAACACCGTGAGTCAGG - Intergenic
940524928 2:154801129-154801151 CTTTGTCAGCTCCATGACTCAGG + Intronic
941804149 2:169693935-169693957 CAGTTGCAGCTCTGAGAGTCTGG - Intronic
942296986 2:174527456-174527478 GTATTTCAGATCCGAGAGTCAGG + Intergenic
943650387 2:190451621-190451643 TTGTTTCAGCTCGGTTAGGCTGG + Intronic
945057977 2:205884751-205884773 CTTGCTCAGCTCCCTGAGTCTGG + Intergenic
1171414222 20:24966681-24966703 CTGTTTAATCTCCTTCAGTCTGG - Intronic
1172056765 20:32159548-32159570 CTGTTTCATCTGTGTGACTCTGG + Intronic
1174165000 20:48578199-48578221 CAGTTTGAGCTCCGTGACCCTGG + Intergenic
1177606548 21:23386116-23386138 GTTTTTCAGCTTCGTGAATCAGG + Intergenic
1178823339 21:35994676-35994698 CTGGGTCAGGTCAGTGAGTCAGG - Intronic
951708330 3:25566122-25566144 CTGTGTCACCTCCATGATTCTGG + Intronic
955093664 3:55776007-55776029 CTGTCTCAGCTCAGTGAGACTGG - Intronic
959200685 3:103242843-103242865 CTGTTTCTGCTCCGGGGGTCTGG - Intergenic
978392936 4:108246536-108246558 CTGTTTGAGCCCCCTGAGTCTGG + Intergenic
981007398 4:139889978-139890000 CTGTTTCTGCTGCATGAGTTTGG + Exonic
982332993 4:154202824-154202846 CTGTTTCAGCTCCCTTAGTTTGG - Intergenic
989349967 5:40474773-40474795 CTGGTTCAGCTCACTGAGACTGG - Intergenic
993673283 5:90787703-90787725 CTGTTTCAGCTCCGAGTAGCTGG + Intronic
995643024 5:114278887-114278909 CTGGTTCATCTCATTGAGTCTGG - Intergenic
995677652 5:114681298-114681320 CTGTTCCCTCTCCTTGAGTCTGG - Intergenic
998367065 5:141638397-141638419 CAGCTTCAGCCCCGTGAGTGAGG + Exonic
1013079273 6:106798421-106798443 CAGTTTCAGCTGAGTGTGTCTGG - Intergenic
1019835199 7:3376575-3376597 CTTTTTCACCTCTGTGAATCTGG - Intronic
1021408319 7:20299867-20299889 CTGCTTCAGCTCTGAGAGTCAGG + Intergenic
1023911648 7:44560701-44560723 CTGTGTCACCTCCATGACTCAGG - Intergenic
1024675096 7:51631165-51631187 CTGTCTCACCTCCGTGCCTCGGG + Intergenic
1026770612 7:73195648-73195670 CTGTTTTAGGTCCGTGATTTTGG - Intergenic
1026844181 7:73688421-73688443 CTGTGTCAGCTTTGTGTGTCTGG + Intronic
1027011480 7:74749037-74749059 CTGTTTTAGGTCCGTGATTTTGG - Intronic
1027076560 7:75197005-75197027 CTGTTTTAGGTCCGTGATTTTGG + Intergenic
1030297629 7:107944741-107944763 CTGCTTCAGCCACGTGAGTGTGG - Intronic
1031588144 7:123557598-123557620 GTGGTTCCGCTCCGAGAGTCAGG - Intronic
1035327714 7:158075657-158075679 CTGTGTCTGTGCCGTGAGTCAGG + Intronic
1038449029 8:27627044-27627066 GTTTTTTAGCTCCCTGAGTCAGG - Intergenic
1046737615 8:117793992-117794014 GTGTTGCAGCTCCATGATTCAGG - Intergenic
1047138026 8:122103518-122103540 CTGAGTCAGCTTCATGAGTCTGG + Intergenic
1051196101 9:14564398-14564420 CTCTTTCATCTCCCTGAGCCTGG + Intergenic
1051486134 9:17610072-17610094 CAGTTTTAACTCTGTGAGTCTGG + Intronic
1051761415 9:20469543-20469565 CTGTTTCATCTCCTTGAATAGGG - Intronic
1061242485 9:129382676-129382698 TTGTTTCAGCTGGGTGAGCCTGG - Intergenic
1062061291 9:134496682-134496704 CTGTTTCAGCTCTGGGTGGCGGG + Intergenic