ID: 1143426169

View in Genome Browser
Species Human (GRCh38)
Location 17:6840276-6840298
Sequence AAAAATTCCCAATTAAAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143426169_1143426175 24 Left 1143426169 17:6840276-6840298 CCTATTTTTAATTGGGAATTTTT No data
Right 1143426175 17:6840323-6840345 ATGTAAGGTATATAACTTGCAGG No data
1143426169_1143426172 9 Left 1143426169 17:6840276-6840298 CCTATTTTTAATTGGGAATTTTT No data
Right 1143426172 17:6840308-6840330 CTCCAGTGCCTCATTATGTAAGG No data
1143426169_1143426176 25 Left 1143426169 17:6840276-6840298 CCTATTTTTAATTGGGAATTTTT No data
Right 1143426176 17:6840324-6840346 TGTAAGGTATATAACTTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143426169 Original CRISPR AAAAATTCCCAATTAAAAAT AGG (reversed) Intergenic
No off target data available for this crispr